View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3640_low_70 (Length: 214)
Name: NF3640_low_70
Description: NF3640
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3640_low_70 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 127; Significance: 9e-66; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 127; E-Value: 9e-66
Query Start/End: Original strand, 1 - 172
Target Start/End: Complemental strand, 43614153 - 43613982
Alignment:
| Q |
1 |
ttttgtagtaattatatgtttgtagcaattttttaaattgtacttcannnnnnncttgttttactagacttattcgtgtcaattatcctgtttgcagaat |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43614153 |
ttttgtagtaattatatgtttgtagcaattttttaaattgtacttcatttttttcttgttttactagacttattcgtgtcaattatcctgtttgcagaat |
43614054 |
T |
|
| Q |
101 |
atttcaacatgtannnnnnnncttcttcctgttgcatcttaactttagtcaatatgtttctttaatctgaat |
172 |
Q |
| |
|
||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43614053 |
atttcaacatgtattttttttcttcttcctgttgcatcttaactttagtcaatatgtttctttaatctgaat |
43613982 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 66; E-Value: 2e-29
Query Start/End: Original strand, 1 - 163
Target Start/End: Complemental strand, 43645823 - 43645662
Alignment:
| Q |
1 |
ttttgtagtaattatatgtttgtagcaattttttaaattgtacttcannnnnnncttgttttactagacttattcgtgtcaattatcctgtttgcagaat |
100 |
Q |
| |
|
|||||||||| |||||||||||||||||||| ||||||| ||||||| ||||||||| ||| |||||| ||||||||||||||||||||||| | |
|
|
| T |
43645823 |
ttttgtagtagttatatgtttgtagcaatttcttaaattttacttcatttttttcttgttttattagccttatttgtgtcaattatcctgtttgcagagt |
43645724 |
T |
|
| Q |
101 |
atttcaacatgtannnnnnnncttcttcctgttgcatcttaactttagtcaatatgtttcttt |
163 |
Q |
| |
|
|||||||| || | ||||||||||||| |||||||| ||| ||||||||||||||| |
|
|
| T |
43645723 |
atttcaacgtgcattttttttcttcttcctgttgtatcttaac-ttaatcaatatgtttcttt |
43645662 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University