View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3641_low_4 (Length: 397)
Name: NF3641_low_4
Description: NF3641
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3641_low_4 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 192; Significance: 1e-104; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 192; E-Value: 1e-104
Query Start/End: Original strand, 179 - 378
Target Start/End: Original strand, 3521342 - 3521541
Alignment:
| Q |
179 |
catagtgtgaattttgatgatctaatgcgatgaatgttgttgttattaatattattgtaaggttgataataatatttttctggttttgagggtaatatac |
278 |
Q |
| |
|
|||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||| |
|
|
| T |
3521342 |
catagtgtgaattttgatgatctaatgcgaagaatgttgttgttattaatattattgtaaggttgataatgatatttttctggttttgagggtaatatac |
3521441 |
T |
 |
| Q |
279 |
ctatgccacccatgttcaatttcagaattcaattgacggtgttcgttcttgtttgttgatttcgagggttttgacttatgttgactatctatctatgacc |
378 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3521442 |
ctatgccacccatgttcaatttcagaattcaattgacggtgttcgttcttgtttgttgatttcgagggttttgacttatgttgactatctatctatgacc |
3521541 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 107; E-Value: 2e-53
Query Start/End: Original strand, 15 - 121
Target Start/End: Original strand, 3521178 - 3521284
Alignment:
| Q |
15 |
gaacggtgagtggtgaaccggagggagagttatggcgggttgatttggtgacccgtttttcccattcgggtccgccccatgaatttttggtgggaagtga |
114 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3521178 |
gaacggtgagtggtgaaccggagggagagttatggcgggttgatttggtgacccgtttttcccattcgggtccgccccatgaatttttggtgggaagtga |
3521277 |
T |
 |
| Q |
115 |
tgacgtg |
121 |
Q |
| |
|
||||||| |
|
|
| T |
3521278 |
tgacgtg |
3521284 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University