View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3642_high_4 (Length: 227)
Name: NF3642_high_4
Description: NF3642
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3642_high_4 |
 |  |
|
| [»] chr3 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 173; Significance: 4e-93; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 173; E-Value: 4e-93
Query Start/End: Original strand, 1 - 227
Target Start/End: Original strand, 4031315 - 4031556
Alignment:
| Q |
1 |
atatgatatgacaataattataatctctcctaattgactttaattgtagatggttgattttaaccttctcttcaattaattaacaaat------------ |
88 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4031315 |
atatgatatgacaataattataatctctcctaattgactttaattgtagatggttgattttaaccttctcttcaattaattaacaaataaagggatatca |
4031414 |
T |
 |
| Q |
89 |
---gaagggatatgcttgttttttgtttctttgtaattgtcttcatagttctataaatatgttaatcatagatatataagattatagtaacatatttgtt |
185 |
Q |
| |
|
|||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4031415 |
aatgaagggatatgcttgttttttgtttctt-gtaattgtcttcatagttctataaatatgttaatcatagatatataagattatagtaacatatttgtt |
4031513 |
T |
 |
| Q |
186 |
ggggaagttcaaggaactttgga-aaataggtcgtctctttta |
227 |
Q |
| |
|
||||||||||||||||||||||| ||||||||| ||||||||| |
|
|
| T |
4031514 |
ggggaagttcaaggaactttggacaaataggtcatctctttta |
4031556 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University