View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3642_low_4 (Length: 248)
Name: NF3642_low_4
Description: NF3642
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3642_low_4 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 120; Significance: 2e-61; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 120; E-Value: 2e-61
Query Start/End: Original strand, 60 - 228
Target Start/End: Complemental strand, 30524310 - 30524150
Alignment:
| Q |
60 |
cttcaaagagcctagcagcgaaactcgcgcatacttagtttgatgagaaatagggaattgcgggttcaaccctgcaccccatgatatcaaatgtccctgc |
159 |
Q |
| |
|
||||||||||||||||||||||||||||||||| ||||| ||||||||||||||||||| |||||||||||||||| |||||||||||||||| |
|
|
| T |
30524310 |
cttcaaagagcctagcagcgaaactcgcgcataattagtatgatgagaaatagggaattacgggttcaaccctgca--------tatcaaatgtccctgc |
30524219 |
T |
|
| Q |
160 |
aactatttatcatctgagttgtacttacatactagattagctcattaagtgatatttatactaattatt |
228 |
Q |
| |
|
||||||||||||||||||||||||||||| ||||||||||||||||||||||||| ||||||||||||| |
|
|
| T |
30524218 |
aactatttatcatctgagttgtacttacagactagattagctcattaagtgatatatatactaattatt |
30524150 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 30; Significance: 0.00000008; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 114 - 187
Target Start/End: Original strand, 40094662 - 40094735
Alignment:
| Q |
114 |
gaattgcgggttcaaccctgcaccccatgatatcaaatgtccctgcaactatttatcatctgagttgtacttac |
187 |
Q |
| |
|
|||||| |||||||| ||||| ||| ||||||||||||||||||| |||| |||||||||||||||||| |
|
|
| T |
40094662 |
gaattgtgggttcaaacctgcgttccaacatatcaaatgtccctgcaaaattttaccatctgagttgtacttac |
40094735 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University