View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3643_low_7 (Length: 239)
Name: NF3643_low_7
Description: NF3643
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3643_low_7 |
 |  |
|
| [»] chr4 (2 HSPs) |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 138; Significance: 3e-72; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 138; E-Value: 3e-72
Query Start/End: Original strand, 82 - 239
Target Start/End: Original strand, 42547719 - 42547876
Alignment:
| Q |
82 |
atgccactggcctacaaatgtaggtttgctgcatgcaaaagatgaatttcaatcggcatctctcaaattttaatataccctatccaaccaaagcactaaa |
181 |
Q |
| |
|
||||| |||||||||||||||||||||||||| ||||||||||||||||||||||| |||||||||||| |||||||||||||| ||||||||||||||| |
|
|
| T |
42547719 |
atgccgctggcctacaaatgtaggtttgctgcgtgcaaaagatgaatttcaatcggtatctctcaaattctaatataccctatctaaccaaagcactaaa |
42547818 |
T |
 |
| Q |
182 |
gatgtgttgaagaaaaccattagaaccaaatctaaacatagatatcctaaattgtttc |
239 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42547819 |
gatgtgttgaagaaaaccattagaaccaaatctaaacatagatatcctaaattgtttc |
42547876 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 71; E-Value: 3e-32
Query Start/End: Original strand, 18 - 88
Target Start/End: Original strand, 42546926 - 42546996
Alignment:
| Q |
18 |
attactaatggaaagagtttctacggaatatcatagaagcaaaaaattgtatgagcttaacatcatgccac |
88 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42546926 |
attactaatggaaagagtttctacggaatatcatagaagcaaaaaattgtatgagcttaacatcatgccac |
42546996 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University