View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3644_high_8 (Length: 255)
Name: NF3644_high_8
Description: NF3644
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3644_high_8 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 232; Significance: 1e-128; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 232; E-Value: 1e-128
Query Start/End: Original strand, 1 - 240
Target Start/End: Original strand, 18019818 - 18020057
Alignment:
| Q |
1 |
aaatagatatctgaatctatagatggagtttcagtgtctgcaaaggaatcaacagcctcccgaggtcgtctcattaaatatagaatcactaaaatcaaaa |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
18019818 |
aaatagatatctgaatctatagatggagtttcagtgtctgcaaaggaatcaacagcctcccgaggtcgtctcattaaatatagaatcactaaaatcaaaa |
18019917 |
T |
|
| Q |
101 |
tgagagaaacaccaccaacagtagctgcaatgattatgacaattttagcacggggaagattagcatctttcgccggatgagtagagcggggagctgaaat |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||| |||||||||||| |
|
|
| T |
18019918 |
tgagagaaacaccaccaacagtagctgcaatgattatgacaattttagcacgggaaagattagcatctttcgccggatgagtagagcagggagctgaaat |
18020017 |
T |
|
| Q |
201 |
tctattgcagtcaccgagaggtgtaccgcaaagacctatg |
240 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
18020018 |
tctattgcagtcaccgagaggtgtaccgcaaagacctatg |
18020057 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University