View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3644_low_18 (Length: 210)
Name: NF3644_low_18
Description: NF3644
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3644_low_18 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 165; Significance: 2e-88; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 165; E-Value: 2e-88
Query Start/End: Original strand, 12 - 192
Target Start/End: Original strand, 25430342 - 25430522
Alignment:
| Q |
12 |
caaaggaaacaaagtgctttcaagcaacaatgatagaccaggtagtttatccatggcatagaatatgtggttgtttgaacaacaaaagtttgtgtcaact |
111 |
Q |
| |
|
|||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
25430342 |
caaaagaaacaaagtgctttcaagcaacaatgatagaccaggtagtttatccatggcataaaatatgtggttgtttgaacaacaaaagtttgtgtcaact |
25430441 |
T |
|
| Q |
112 |
aagataaaagaaatatggtggttggtgcacttactatgaaagttcttgaagactcgattagcatctgtttgctaggcaagc |
192 |
Q |
| |
|
||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||| |
|
|
| T |
25430442 |
aagataaaaaaaatatggtggttggtgcacttactatgaaagttcttgaagactcgattagcatctgcttgctaggcaagc |
25430522 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University