View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3645_low_10 (Length: 278)
Name: NF3645_low_10
Description: NF3645
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3645_low_10 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 251; Significance: 1e-139; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 251; E-Value: 1e-139
Query Start/End: Original strand, 19 - 273
Target Start/End: Complemental strand, 30319502 - 30319248
Alignment:
| Q |
19 |
ccgacgagcctttctgggaatttctggaagattttctccttgtgacccatctgactggatcaatgaatcattggaaccatctgaagaatctttaaggttt |
118 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
30319502 |
ccgacgagcctttctgggaatttctggaagattttctccttgtgacccatctgactggatcaatgaatcattggaaccatctgaagaatctttaaggttt |
30319403 |
T |
|
| Q |
119 |
gactgtttgttagctgatgaccttcttgattgccttgtcctttcccttgttggagaatctgttatgttactattcatttgtcttctagatccttttggca |
218 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||| |
|
|
| T |
30319402 |
gactgtttgttagctgatgaccttcttgattgccttgtcctttcccttgttggagaatctgtgatgttactattcatttgtcttctagatccttttggca |
30319303 |
T |
|
| Q |
219 |
attcaggcaaatccctcccttgagtttgagaattcacaccccttgtacttcttct |
273 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
30319302 |
attcaggcaaatccctcccttgagtttgagaattcacaccccttgtacttcttct |
30319248 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University