View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3646_low_10 (Length: 263)
Name: NF3646_low_10
Description: NF3646
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3646_low_10 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 157; Significance: 1e-83; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 157; E-Value: 1e-83
Query Start/End: Original strand, 63 - 251
Target Start/End: Complemental strand, 9448306 - 9448118
Alignment:
| Q |
63 |
ctagttgatcattttcagtagaggtctctccttctaacaatattgttttctatatacagagataaatcatcttattttaaagatgagtttagcttcactt |
162 |
Q |
| |
|
||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
9448306 |
ctagttgatcatttttagtagaggtctctccttctaacaatattgttttctatatacagagataaatcatcttattttaaagatgagtttagcttcactt |
9448207 |
T |
 |
| Q |
163 |
taacannnnnnnnataggcaaatatttgtaatttgatgttacattaacattttctctttgtctaaagtttgaaacatccaattcattca |
251 |
Q |
| |
|
||||| |||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
9448206 |
taacatttttttaataggcaaatatttgtaatttgatgttacattaatattttctctttgtctaaagtttgaaacatccaattcattca |
9448118 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 1 - 45
Target Start/End: Complemental strand, 9448348 - 9448304
Alignment:
| Q |
1 |
cagttgcacgacgaattttatctgattcacgctaatcaattgcta |
45 |
Q |
| |
|
|||||||| |||||||||||||||||||||||||||||||||||| |
|
|
| T |
9448348 |
cagttgcatgacgaattttatctgattcacgctaatcaattgcta |
9448304 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University