View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3646_low_13 (Length: 230)
Name: NF3646_low_13
Description: NF3646
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3646_low_13 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 72; Significance: 7e-33; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 72; E-Value: 7e-33
Query Start/End: Original strand, 142 - 213
Target Start/End: Complemental strand, 48565444 - 48565373
Alignment:
| Q |
142 |
atagaataagcctttggtcatcatggttagactagactgtagaaatctcggaaattcactagcggtatttaa |
213 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
48565444 |
atagaataagcctttggtcatcatggttagactagactgtagaaatctcggaaattcactagcggtatttaa |
48565373 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 57; E-Value: 6e-24
Query Start/End: Original strand, 70 - 130
Target Start/End: Complemental strand, 48565548 - 48565488
Alignment:
| Q |
70 |
agagaaaaaagagggagattgcacacacttcaaatatgatgattcaatttcccatccctca |
130 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
48565548 |
agagaaaaaagagggagattgcacacacttcaaatatgatgattcaatttcccatacctca |
48565488 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University