View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3647_high_8 (Length: 221)
Name: NF3647_high_8
Description: NF3647
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3647_high_8 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 162; Significance: 1e-86; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 162; E-Value: 1e-86
Query Start/End: Original strand, 36 - 205
Target Start/End: Complemental strand, 1216339 - 1216170
Alignment:
| Q |
36 |
cacatcgacatgagcaaaactctgttggtgaaaggaagcattaactgccaccgtgatattggggtgaatcgcccttaactgccacttttcctataaacag |
135 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||| |
|
|
| T |
1216339 |
cacatcgacatgagcaaaactctgttggtgaaaggaagcattaactgccaccgtgatattggggtgaatcggccttaactgccacttttcctataaacag |
1216240 |
T |
|
| Q |
136 |
aacaccgttacctatattgcaaaatagacccgtttttggactgttgtttgacaagccacctgattatagc |
205 |
Q |
| |
|
||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||| |
|
|
| T |
1216239 |
aacaccgttacctatattgcaaaatagacccctttttggactgttgtttgacaagccacctgattatagc |
1216170 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 30; E-Value: 0.00000007
Query Start/End: Original strand, 128 - 189
Target Start/End: Complemental strand, 41102900 - 41102839
Alignment:
| Q |
128 |
ataaacagaacaccgttacctatattgcaaaatagacccgtttttggactgttgtttgacaa |
189 |
Q |
| |
|
|||||| ||||||||| |||||||||||||||||| || ||||| |||| |||||||||| |
|
|
| T |
41102900 |
ataaacggaacaccgtcgcctatattgcaaaatagatccccttttgaactggtgtttgacaa |
41102839 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University