View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3648_high_35 (Length: 264)
Name: NF3648_high_35
Description: NF3648
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3648_high_35 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 89; Significance: 6e-43; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 89; E-Value: 6e-43
Query Start/End: Original strand, 106 - 218
Target Start/End: Complemental strand, 6743194 - 6743082
Alignment:
| Q |
106 |
tctattcaaaggtgtgaaggatagattactctcggttgtgcaagtctcgtccttaattgtaatattggatcagacacgtattttagtcttatactcaatc |
205 |
Q |
| |
|
|||||||||||||||||| ||| |||||||||| |||||||||||||||||||||||||| |||||||||||||||||||||||||||||||| |||||| |
|
|
| T |
6743194 |
tctattcaaaggtgtgaatgatggattactctcagttgtgcaagtctcgtccttaattgtgatattggatcagacacgtattttagtcttatattcaatc |
6743095 |
T |
 |
| Q |
206 |
cttaattagatga |
218 |
Q |
| |
|
|||||||||||| |
|
|
| T |
6743094 |
gttaattagatga |
6743082 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University