View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF3648_high_35 (Length: 264)

Name: NF3648_high_35
Description: NF3648
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF3648_high_35
NF3648_high_35
[»] chr1 (1 HSPs)
chr1 (106-218)||(6743082-6743194)


Alignment Details
Target: chr1 (Bit Score: 89; Significance: 6e-43; HSPs: 1)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 89; E-Value: 6e-43
Query Start/End: Original strand, 106 - 218
Target Start/End: Complemental strand, 6743194 - 6743082
Alignment:
106 tctattcaaaggtgtgaaggatagattactctcggttgtgcaagtctcgtccttaattgtaatattggatcagacacgtattttagtcttatactcaatc 205  Q
    |||||||||||||||||| ||| |||||||||| |||||||||||||||||||||||||| |||||||||||||||||||||||||||||||| ||||||    
6743194 tctattcaaaggtgtgaatgatggattactctcagttgtgcaagtctcgtccttaattgtgatattggatcagacacgtattttagtcttatattcaatc 6743095  T
206 cttaattagatga 218  Q
     ||||||||||||    
6743094 gttaattagatga 6743082  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University