View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3648_high_36 (Length: 262)
Name: NF3648_high_36
Description: NF3648
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3648_high_36 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 210; Significance: 1e-115; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 210; E-Value: 1e-115
Query Start/End: Original strand, 34 - 243
Target Start/End: Original strand, 32683601 - 32683810
Alignment:
| Q |
34 |
aaaaaataacatccacttgaagatacttgtatgaaccaactaggaaggaagggacttttatgtactccattgttagataataaagggactttcgttccat |
133 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32683601 |
aaaaaataacatccacttgaagatacttgtatgaaccaactaggaaggaagggacttttatgtactccattgttagataataaagggactttcgttccat |
32683700 |
T |
 |
| Q |
134 |
gtcgacactagccctagcacattgctcttgttatgttacgtccatagaattattcaaccaaaaaatttggaacataatcatgactgatccaaaacaatag |
233 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32683701 |
gtcgacactagccctagcacattgctcttgttatgttacgtccatagaattattcaaccaaaaaatttggaacataatcatgactgatccaaaacaatag |
32683800 |
T |
 |
| Q |
234 |
taatcgatgt |
243 |
Q |
| |
|
|||||||||| |
|
|
| T |
32683801 |
taatcgatgt |
32683810 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University