View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3648_high_48 (Length: 236)
Name: NF3648_high_48
Description: NF3648
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3648_high_48 |
 | |
|
| [»] chr1 (1 HSPs) |
| |
|
Alignment Details
Target: chr1 (Bit Score: 219; Significance: 1e-120; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 219; E-Value: 1e-120
Query Start/End: Original strand, 14 - 236
Target Start/End: Complemental strand, 45973497 - 45973275
Alignment:
| Q |
14 |
caaattcagtgttcaaccgtgggtcagtgtcatgaacagaactgaaattatgtagacgagcctcaaaggaagaacaatgtgagaaacccagagtgtgtcc |
113 |
Q |
| |
|
|||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45973497 |
caaattcagtgttcaatcgtgggtcagtgtcatgaacagaactgaaattatgtagacgagcctcaaaggaagaacaatgtgagaaacccagagtgtgtcc |
45973398 |
T |
|
| Q |
114 |
tccagataaagtcaccatatctttaactcccaaccctctcttagcaaagctctgaatgagttggcctacattcaaggttggggccggtaagttggcggta |
213 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45973397 |
tccagataaagtcaccatatctttaactcccaaccctctcttagcaaagctctgaatgagttggcctacattcaaggttggggccggtaagttggcggta |
45973298 |
T |
|
| Q |
214 |
tcagatgcctttgatacccttcc |
236 |
Q |
| |
|
||||||||||||||||||||||| |
|
|
| T |
45973297 |
tcagatgcctttgatacccttcc |
45973275 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University