View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3648_high_53 (Length: 224)
Name: NF3648_high_53
Description: NF3648
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3648_high_53 |
 |  |
|
| [»] chr3 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 93; Significance: 2e-45; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 93; E-Value: 2e-45
Query Start/End: Original strand, 128 - 224
Target Start/End: Complemental strand, 21868484 - 21868388
Alignment:
| Q |
128 |
gtttgcttatatgagaaatggtttgattgtgaggacattctatgtggaataatgagttggaacccggttcaccacattttcccctctccgtgtgtgt |
224 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||| |
|
|
| T |
21868484 |
gtttgcttatatgagaaatggtttgattgtgaggacattctatgtggaataatgagttggaacccggttcaccacattttcccttctccgtgtgtgt |
21868388 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University