View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF3648_high_55 (Length: 217)

Name: NF3648_high_55
Description: NF3648
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF3648_high_55
NF3648_high_55
[»] chr4 (14 HSPs)
chr4 (7-192)||(2165459-2165644)
chr4 (52-130)||(26474832-26474911)
chr4 (75-129)||(2792281-2792335)
chr4 (43-122)||(39041288-39041368)
chr4 (67-108)||(16501742-16501784)
chr4 (75-110)||(46698811-46698846)
chr4 (53-106)||(6599975-6600029)
chr4 (78-120)||(32057136-32057178)
chr4 (77-110)||(35800511-35800544)
chr4 (75-120)||(40813797-40813842)
chr4 (78-110)||(25753195-25753227)
chr4 (78-122)||(30167578-30167622)
chr4 (75-107)||(38637261-38637293)
chr4 (75-107)||(39421042-39421074)
[»] chr6 (12 HSPs)
chr6 (31-121)||(34105388-34105479)
chr6 (8-145)||(20970397-20970534)
chr6 (75-110)||(32935365-32935400)
chr6 (85-121)||(34090393-34090429)
chr6 (75-122)||(3117513-3117560)
chr6 (79-110)||(9224065-9224096)
chr6 (75-110)||(21266133-21266168)
chr6 (75-110)||(26216045-26216080)
chr6 (79-110)||(33968639-33968670)
chr6 (75-113)||(9239221-9239259)
chr6 (53-101)||(20499916-20499965)
chr6 (55-122)||(30413956-30414023)
[»] scaffold0620 (1 HSPs)
scaffold0620 (14-121)||(3788-3896)
[»] chr1 (20 HSPs)
chr1 (54-145)||(15840903-15840995)
chr1 (75-117)||(30655580-30655622)
chr1 (75-122)||(5389435-5389482)
chr1 (75-122)||(19598656-19598703)
chr1 (75-122)||(31585774-31585821)
chr1 (75-110)||(38544764-38544799)
chr1 (8-118)||(41403016-41403127)
chr1 (75-122)||(41920472-41920519)
chr1 (53-122)||(46814481-46814551)
chr1 (66-122)||(36132746-36132803)
chr1 (80-136)||(2660840-2660896)
chr1 (53-107)||(7857650-7857705)
chr1 (75-110)||(27102211-27102246)
chr1 (75-122)||(30685918-30685965)
chr1 (75-109)||(4651800-4651834)
chr1 (84-117)||(32876645-32876678)
chr1 (75-104)||(38564921-38564950)
chr1 (75-107)||(5459181-5459213)
chr1 (53-108)||(24658926-24658982)
chr1 (77-109)||(42374185-42374217)
[»] scaffold0572 (1 HSPs)
scaffold0572 (8-145)||(6247-6384)
[»] scaffold0127 (1 HSPs)
scaffold0127 (8-145)||(31208-31345)
[»] chr3 (14 HSPs)
chr3 (53-128)||(30127259-30127336)
chr3 (55-122)||(19176501-19176569)
chr3 (55-122)||(43012374-43012442)
chr3 (75-122)||(17550977-17551024)
chr3 (53-122)||(23328364-23328434)
chr3 (53-109)||(31424233-31424290)
chr3 (55-107)||(34475783-34475836)
chr3 (78-110)||(5556593-5556625)
chr3 (53-111)||(24099352-24099411)
chr3 (75-110)||(47945726-47945761)
chr3 (75-145)||(19295856-19295926)
chr3 (78-110)||(9584079-9584111)
chr3 (34-128)||(24991922-24992018)
chr3 (78-110)||(33143975-33144007)
[»] chr8 (10 HSPs)
chr8 (67-122)||(16457475-16457530)
chr8 (75-122)||(24995409-24995456)
chr8 (75-122)||(31207376-31207423)
chr8 (78-110)||(30236154-30236186)
chr8 (75-122)||(9519519-9519566)
chr8 (75-110)||(10552288-10552323)
chr8 (45-121)||(16055215-16055292)
chr8 (85-122)||(37986872-37986909)
chr8 (53-108)||(15821407-15821463)
chr8 (78-110)||(17657028-17657060)
[»] chr2 (13 HSPs)
chr2 (34-120)||(9560804-9560891)
chr2 (75-122)||(39338879-39338926)
chr2 (34-131)||(37830981-37831079)
chr2 (48-108)||(14405190-14405251)
chr2 (55-107)||(23650384-23650437)
chr2 (45-128)||(8520391-8520475)
chr2 (75-110)||(4471943-4471978)
chr2 (75-110)||(16960002-16960037)
chr2 (75-110)||(22885159-22885194)
chr2 (75-110)||(33788658-33788693)
chr2 (53-122)||(7874288-7874358)
chr2 (75-108)||(2062909-2062942)
chr2 (75-107)||(10524117-10524149)
[»] scaffold0236 (1 HSPs)
scaffold0236 (85-145)||(10392-10452)
[»] chr7 (19 HSPs)
chr7 (67-110)||(12480897-12480941)
chr7 (75-122)||(10244202-10244249)
chr7 (76-109)||(11379154-11379187)
chr7 (53-108)||(6584906-6584962)
chr7 (74-110)||(6716762-6716798)
chr7 (85-180)||(6718799-6718895)
chr7 (75-119)||(46262136-46262180)
chr7 (75-110)||(13311859-13311894)
chr7 (75-122)||(38306281-38306328)
chr7 (75-122)||(47325899-47325946)
chr7 (75-109)||(38485576-38485610)
chr7 (76-110)||(46133304-46133338)
chr7 (53-105)||(26386206-26386259)
chr7 (75-108)||(34389982-34390015)
chr7 (67-110)||(3478363-3478407)
chr7 (75-107)||(5860317-5860349)
chr7 (75-107)||(9349769-9349801)
chr7 (78-110)||(33435132-33435164)
chr7 (78-122)||(48058668-48058712)
[»] chr5 (9 HSPs)
chr5 (79-147)||(28765591-28765659)
chr5 (75-110)||(31721697-31721732)
chr5 (75-110)||(34378118-34378153)
chr5 (76-110)||(7195265-7195299)
chr5 (53-110)||(7392057-7392115)
chr5 (67-119)||(12046266-12046320)
chr5 (61-110)||(22675350-22675400)
chr5 (67-107)||(39024479-39024520)
chr5 (75-107)||(13954263-13954295)
[»] scaffold1613 (1 HSPs)
scaffold1613 (75-110)||(1043-1078)
[»] scaffold0267 (1 HSPs)
scaffold0267 (75-145)||(9113-9183)
[»] scaffold0068 (1 HSPs)
scaffold0068 (75-107)||(35800-35832)


Alignment Details
Target: chr4 (Bit Score: 166; Significance: 5e-89; HSPs: 14)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 166; E-Value: 5e-89
Query Start/End: Original strand, 7 - 192
Target Start/End: Original strand, 2165459 - 2165644
Alignment:
7 cttaatatgacttctctggtgttctgagagttgagtgatgccttggtgatttgtttctagagtttggtggccgatcgcttttgattcgagatcgggagtc 106  Q
    ||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||    
2165459 cttaatatgacttctctggtggtctgagagttgagtgatgccttggtgatttgtttctagagtttggtggccgatcgcttttgatttgagatcgggagtc 2165558  T
107 agtttcttgactcaagcttttttgcttgttatagtgtctctatggcacactgggggttgattggtggtggaattcggacaagcatc 192  Q
    ||||||||||||||||||||||||||||||||| ||||||| ||||||||||||||||||||||||||||||||| ||||||||||    
2165559 agtttcttgactcaagcttttttgcttgttatattgtctctctggcacactgggggttgattggtggtggaattcagacaagcatc 2165644  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #2
Raw Score: 44; E-Value: 3e-16
Query Start/End: Original strand, 52 - 130
Target Start/End: Original strand, 26474832 - 26474911
Alignment:
52 gtgatttgtttctagagtttggtgg-ccgatcgcttttgattcgagatcgggagtcagtttcttgactcaagcttttttg 130  Q
    ||||||||||| | ||||||||||| |||||| ||||||||||||||||| |||| ||||||||| |||||||| |||||    
26474832 gtgatttgtttttggagtttggtgggccgatcacttttgattcgagatcgagagttagtttcttgtctcaagctgttttg 26474911  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #3
Raw Score: 43; E-Value: 0.000000000000001
Query Start/End: Original strand, 75 - 129
Target Start/End: Complemental strand, 2792335 - 2792281
Alignment:
75 ggccgatcgcttttgattcgagatcgggagtcagtttcttgactcaagctttttt 129  Q
    |||||||| |||||||||||||||||| |||||||||||||||||||| ||||||    
2792335 ggccgatcacttttgattcgagatcggaagtcagtttcttgactcaagttttttt 2792281  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #4
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 43 - 122
Target Start/End: Complemental strand, 39041368 - 39041288
Alignment:
43 gatgccttggtgatttgtttctagagtttggtgg-ccgatcgcttttgattcgagatcgggagtcagtttcttgactcaag 122  Q
    ||||||||  ||||||||||  ||||| |||||| |||||| |||||||||||||||| ||||||||||||| ||||||||    
39041368 gatgccttaatgatttgtttacagagtctggtgggccgatcacttttgattcgagatcaggagtcagtttctagactcaag 39041288  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #5
Raw Score: 35; E-Value: 0.00000000008
Query Start/End: Original strand, 67 - 108
Target Start/End: Original strand, 16501742 - 16501784
Alignment:
67 agtttggtgg-ccgatcgcttttgattcgagatcgggagtcag 108  Q
    |||||||||| ||||||||||||||||||||||||||||||||    
16501742 agtttggtgggccgatcgcttttgattcgagatcgggagtcag 16501784  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #6
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 75 - 110
Target Start/End: Complemental strand, 46698846 - 46698811
Alignment:
75 ggccgatcgcttttgattcgagatcgggagtcagtt 110  Q
    ||||||| ||||||||||||||||||||||||||||    
46698846 ggccgattgcttttgattcgagatcgggagtcagtt 46698811  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #7
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 53 - 106
Target Start/End: Complemental strand, 6600029 - 6599975
Alignment:
53 tgatttgtttctagagtttggtgg-ccgatcgcttttgattcgagatcgggagtc 106  Q
    |||||||  |||||||| |||||| |||||||||||||||| |||||||||||||    
6600029 tgatttggctctagagtctggtgggccgatcgcttttgattagagatcgggagtc 6599975  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #8
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 78 - 120
Target Start/End: Original strand, 32057136 - 32057178
Alignment:
78 cgatcgcttttgattcgagatcgggagtcagtttcttgactca 120  Q
    ||||| ||||||||| |||||||| ||||||||||||||||||    
32057136 cgatcacttttgatttgagatcggaagtcagtttcttgactca 32057178  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #9
Raw Score: 30; E-Value: 0.00000007
Query Start/End: Original strand, 77 - 110
Target Start/End: Original strand, 35800511 - 35800544
Alignment:
77 ccgatcgcttttgattcgagatcgggagtcagtt 110  Q
    ||||||||||||||||||||||||| ||||||||    
35800511 ccgatcgcttttgattcgagatcggaagtcagtt 35800544  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #10
Raw Score: 30; E-Value: 0.00000007
Query Start/End: Original strand, 75 - 120
Target Start/End: Complemental strand, 40813842 - 40813797
Alignment:
75 ggccgatcgcttttgattcgagatcgggagtcagtttcttgactca 120  Q
    |||||||| ||||||||||||||||||||| || ||| ||||||||    
40813842 ggccgatcacttttgattcgagatcgggagccaattttttgactca 40813797  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #11
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 78 - 110
Target Start/End: Original strand, 25753195 - 25753227
Alignment:
78 cgatcgcttttgattcgagatcgggagtcagtt 110  Q
    ||||| |||||||||||||||||||||||||||    
25753195 cgatcacttttgattcgagatcgggagtcagtt 25753227  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #12
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 78 - 122
Target Start/End: Complemental strand, 30167622 - 30167578
Alignment:
78 cgatcgcttttgattcgagatcgggagtcagtttcttgactcaag 122  Q
    ||||| ||||||||||||||||||||||| |||  ||||||||||    
30167622 cgatcacttttgattcgagatcgggagtcggttctttgactcaag 30167578  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #13
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 75 - 107
Target Start/End: Complemental strand, 38637293 - 38637261
Alignment:
75 ggccgatcgcttttgattcgagatcgggagtca 107  Q
    |||||||| ||||||||||||||||||||||||    
38637293 ggccgatcacttttgattcgagatcgggagtca 38637261  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #14
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 75 - 107
Target Start/End: Complemental strand, 39421074 - 39421042
Alignment:
75 ggccgatcgcttttgattcgagatcgggagtca 107  Q
    |||||||| ||||||||||||||||||||||||    
39421074 ggccgatcacttttgattcgagatcgggagtca 39421042  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6 (Bit Score: 64; Significance: 4e-28; HSPs: 12)
Name: chr6
Description:

Target: chr6; HSP #1
Raw Score: 64; E-Value: 4e-28
Query Start/End: Original strand, 31 - 121
Target Start/End: Original strand, 34105388 - 34105479
Alignment:
31 tgagagttgagtgatgccttggtgatttgtttctagagtttggtgg-ccgatcgcttttgattcgagatcgggagtcagtttcttgactcaa 121  Q
    ||||||||||  | |||||| ||||||||||||||||||||||||| |||||| ||||||||||||||||||||||||||||||||||||||    
34105388 tgagagttgaagggtgccttagtgatttgtttctagagtttggtgggccgatcacttttgattcgagatcgggagtcagtttcttgactcaa 34105479  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #2
Raw Score: 47; E-Value: 5e-18
Query Start/End: Original strand, 8 - 145
Target Start/End: Complemental strand, 20970534 - 20970397
Alignment:
8 ttaatatgacttctctggtgttctgagagttgagtgatgccttggtgatttgtttctagagtttggtg-gccgatcgcttttgattcgagatcgggagtc 106  Q
    ||||| |||| ||| ||||| || | |||||||| | || ||| |||||||||||||||||| ||||| ||||||| | |||||||||||  ||  ||||    
20970534 ttaatgtgacatctttggtggtccgggagttgaggggtgacttagtgatttgtttctagagtctggtgagccgatcacatttgattcgaggacgaaagtc 20970435  T
107 agtttcttgactcaagcttttttgcttgttatagtgtct 145  Q
    |||||||||||| ||| ||||| ||||||||||||||||    
20970434 agtttcttgacttaag-tttttggcttgttatagtgtct 20970397  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #3
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 75 - 110
Target Start/End: Complemental strand, 32935400 - 32935365
Alignment:
75 ggccgatcgcttttgattcgagatcgggagtcagtt 110  Q
    ||||||||||||||||||||||||||||||||||||    
32935400 ggccgatcgcttttgattcgagatcgggagtcagtt 32935365  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #4
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 85 - 121
Target Start/End: Original strand, 34090393 - 34090429
Alignment:
85 ttttgattcgagatcgggagtcagtttcttgactcaa 121  Q
    ||||||||||||||||||||||||||||| |||||||    
34090393 ttttgattcgagatcgggagtcagtttctagactcaa 34090429  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #5
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 75 - 122
Target Start/End: Original strand, 3117513 - 3117560
Alignment:
75 ggccgatcgcttttgattcgagatcgggagtcagtttcttgactcaag 122  Q
    |||||||| |||||||||| ||||||||||||||||  ||||||||||    
3117513 ggccgatcacttttgattcaagatcgggagtcagttctttgactcaag 3117560  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #6
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 79 - 110
Target Start/End: Original strand, 9224065 - 9224096
Alignment:
79 gatcgcttttgattcgagatcgggagtcagtt 110  Q
    ||||||||||||||||||||||||||||||||    
9224065 gatcgcttttgattcgagatcgggagtcagtt 9224096  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #7
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 75 - 110
Target Start/End: Original strand, 21266133 - 21266168
Alignment:
75 ggccgatcgcttttgattcgagatcgggagtcagtt 110  Q
    ||||||||||||||||||||||||||||||| ||||    
21266133 ggccgatcgcttttgattcgagatcgggagttagtt 21266168  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #8
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 75 - 110
Target Start/End: Complemental strand, 26216080 - 26216045
Alignment:
75 ggccgatcgcttttgattcgagatcgggagtcagtt 110  Q
    |||||||| |||||||||||||||||||||||||||    
26216080 ggccgatcacttttgattcgagatcgggagtcagtt 26216045  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #9
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 79 - 110
Target Start/End: Complemental strand, 33968670 - 33968639
Alignment:
79 gatcgcttttgattcgagatcgggagtcagtt 110  Q
    ||||||||||||||||||||||||||||||||    
33968670 gatcgcttttgattcgagatcgggagtcagtt 33968639  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #10
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 75 - 113
Target Start/End: Complemental strand, 9239259 - 9239221
Alignment:
75 ggccgatcgcttttgattcgagatcgggagtcagtttct 113  Q
    ||||||||| ||||| |||||||||||||||||||||||    
9239259 ggccgatcgtttttgcttcgagatcgggagtcagtttct 9239221  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #11
Raw Score: 30; E-Value: 0.00000007
Query Start/End: Original strand, 53 - 101
Target Start/End: Original strand, 20499916 - 20499965
Alignment:
53 tgatttgtttctagagtttggtgg-ccgatcgcttttgattcgagatcgg 101  Q
    ||||||| |||| |||| |||||| |||||||||||||||||||||||||    
20499916 tgatttgattctggagtatggtggaccgatcgcttttgattcgagatcgg 20499965  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #12
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 55 - 122
Target Start/End: Complemental strand, 30414023 - 30413956
Alignment:
55 atttgtttctagagtttggtggc-cgatcgcttttgattcgagatcgggagtcagtttcttgactcaag 122  Q
    |||| |||||||||||||||||  | ||| ||||||||||||| | | |||||||||||||||||||||    
30414023 atttatttctagagtttggtgggtcaatc-cttttgattcgaggttgagagtcagtttcttgactcaag 30413956  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0620 (Bit Score: 49; Significance: 3e-19; HSPs: 1)
Name: scaffold0620
Description:

Target: scaffold0620; HSP #1
Raw Score: 49; E-Value: 3e-19
Query Start/End: Original strand, 14 - 121
Target Start/End: Original strand, 3788 - 3896
Alignment:
14 tgacttctctggtgttctgagagttgagtgatgccttggtgatttgtttctagagtttggtgg-ccgatcgcttttgattcgagatcgggagtcagtttc 112  Q
    |||||||| |||||  | |||||||||  | |||||  ||||||||||| |||||| |||||| ||||||  ||||||||||||||||||||||||||||    
3788 tgacttctgtggtggaccgagagttgaacggtgcctcagtgatttgtttttagagtctggtgggccgatcaattttgattcgagatcgggagtcagtttc 3887  T
113 ttgactcaa 121  Q
    |||||||||    
3888 ttgactcaa 3896  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1 (Bit Score: 49; Significance: 3e-19; HSPs: 20)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 49; E-Value: 3e-19
Query Start/End: Original strand, 54 - 145
Target Start/End: Complemental strand, 15840995 - 15840903
Alignment:
54 gatttgtttctagagtttggtggcc-gatcgcttttgattcgagatcgggagtcagtttcttgactcaagcttttttgcttgttatagtgtct 145  Q
    |||||||||||||||| |||||| | |||| ||||||||||||||||||||||||||||||||| ||||| |||||  |||||  ||||||||    
15840995 gatttgtttctagagtctggtgggctgatcacttttgattcgagatcgggagtcagtttcttgattcaagttttttgacttgtcttagtgtct 15840903  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #2
Raw Score: 43; E-Value: 0.000000000000001
Query Start/End: Original strand, 75 - 117
Target Start/End: Original strand, 30655580 - 30655622
Alignment:
75 ggccgatcgcttttgattcgagatcgggagtcagtttcttgac 117  Q
    |||||||||||||||||||||||||||||||||||||||||||    
30655580 ggccgatcgcttttgattcgagatcgggagtcagtttcttgac 30655622  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #3
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 75 - 122
Target Start/End: Complemental strand, 5389482 - 5389435
Alignment:
75 ggccgatcgcttttgattcgagatcgggagtcagtttcttgactcaag 122  Q
    |||||||| |||||||||||||||||||||||||||  ||||||||||    
5389482 ggccgatcacttttgattcgagatcgggagtcagttctttgactcaag 5389435  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #4
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 75 - 122
Target Start/End: Original strand, 19598656 - 19598703
Alignment:
75 ggccgatcgcttttgattcgagatcgggagtcagtttcttgactcaag 122  Q
    |||||||||||||||||||||||||| |||||||||  ||||||||||    
19598656 ggccgatcgcttttgattcgagatcgagagtcagttctttgactcaag 19598703  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #5
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 75 - 122
Target Start/End: Complemental strand, 31585821 - 31585774
Alignment:
75 ggccgatcgcttttgattcgagatcgggagtcagtttcttgactcaag 122  Q
    |||||||| |||||||||||||||||||||||||||  ||||||||||    
31585821 ggccgatcacttttgattcgagatcgggagtcagttctttgactcaag 31585774  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #6
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 75 - 110
Target Start/End: Complemental strand, 38544799 - 38544764
Alignment:
75 ggccgatcgcttttgattcgagatcgggagtcagtt 110  Q
    ||||||||||||||||||||||||||||||||||||    
38544799 ggccgatcgcttttgattcgagatcgggagtcagtt 38544764  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #7
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 8 - 118
Target Start/End: Complemental strand, 41403127 - 41403016
Alignment:
8 ttaatatgacttctctggtgttctgagagttgagtgatgccttggtgatttgtttctagagtttggtg-gccgatcgcttttgattcgagatcgggagtc 106  Q
    ||||| |||| ||| ||||| || | |||||||| | || ||| |||||||||||||||||| ||||| ||||||| | |||||||||||  ||  ||||    
41403127 ttaatgtgacatctttggtggtccgggagttgaggggtgacttagtgatttgtttctagagtctggtgagccgatcacatttgattcgaggacgaaagtc 41403028  T
107 agtttcttgact 118  Q
    ||||||||||||    
41403027 agtttcttgact 41403016  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #8
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 75 - 122
Target Start/End: Original strand, 41920472 - 41920519
Alignment:
75 ggccgatcgcttttgattcgagatcgggagtcagtttcttgactcaag 122  Q
    |||||||| |||||||||||||||||||||||||||  ||||||||||    
41920472 ggccgatcacttttgattcgagatcgggagtcagttctttgactcaag 41920519  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #9
Raw Score: 35; E-Value: 0.00000000008
Query Start/End: Original strand, 53 - 122
Target Start/End: Complemental strand, 46814551 - 46814481
Alignment:
53 tgatttgtttctagagtttggtgg-ccgatcgcttttgattcgagatcgggagtcagtttcttgactcaag 122  Q
    ||||||| ||||| ||| |||||| |||||| ||||||||||||||||||||||||| || ||| ||||||    
46814551 tgatttggttctaaagtctggtgggccgatcacttttgattcgagatcgggagtcagctttttggctcaag 46814481  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #10
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 66 - 122
Target Start/End: Complemental strand, 36132803 - 36132746
Alignment:
66 gagtttggtggc-cgatcgcttttgattcgagatcgggagtcagtttcttgactcaag 122  Q
    |||||||||||  ||||||||||||||| |||||||| |||||||||||||| |||||    
36132803 gagtttggtgggtcgatcgcttttgatttgagatcggaagtcagtttcttgattcaag 36132746  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #11
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 80 - 136
Target Start/End: Complemental strand, 2660896 - 2660840
Alignment:
80 atcgcttttgattcgagatcgggagtcagtttcttgactcaagcttttttgcttgtt 136  Q
    ||||||||||||||||||| | |||||| |||||||||||||| | ||| |||||||    
2660896 atcgcttttgattcgagattgagagtcaatttcttgactcaagttgtttggcttgtt 2660840  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #12
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 53 - 107
Target Start/End: Original strand, 7857650 - 7857705
Alignment:
53 tgatttgtttctagagtttggtgg-ccgatcgcttttgattcgagatcgggagtca 107  Q
    ||||||| ||||| ||| |||||| |||||| ||||||||||||||||||||||||    
7857650 tgatttggttctaaagtctggtgggccgatcacttttgattcgagatcgggagtca 7857705  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #13
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 75 - 110
Target Start/End: Original strand, 27102211 - 27102246
Alignment:
75 ggccgatcgcttttgattcgagatcgggagtcagtt 110  Q
    |||||||| |||||||||||||||||||||||||||    
27102211 ggccgatcacttttgattcgagatcgggagtcagtt 27102246  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #14
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 75 - 122
Target Start/End: Complemental strand, 30685965 - 30685918
Alignment:
75 ggccgatcgcttttgattcgagatcgggagtcagtttcttgactcaag 122  Q
    |||||||| ||||||||| |||||||||||||||||  ||||||||||    
30685965 ggccgatcacttttgatttgagatcgggagtcagttctttgactcaag 30685918  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #15
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 75 - 109
Target Start/End: Original strand, 4651800 - 4651834
Alignment:
75 ggccgatcgcttttgattcgagatcgggagtcagt 109  Q
    |||||||| ||||||||||||||||||||||||||    
4651800 ggccgatcacttttgattcgagatcgggagtcagt 4651834  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #16
Raw Score: 30; E-Value: 0.00000007
Query Start/End: Original strand, 84 - 117
Target Start/End: Complemental strand, 32876678 - 32876645
Alignment:
84 cttttgattcgagatcgggagtcagtttcttgac 117  Q
    |||||||||||||||||||||||| |||||||||    
32876678 cttttgattcgagatcgggagtcactttcttgac 32876645  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #17
Raw Score: 30; E-Value: 0.00000007
Query Start/End: Original strand, 75 - 104
Target Start/End: Original strand, 38564921 - 38564950
Alignment:
75 ggccgatcgcttttgattcgagatcgggag 104  Q
    ||||||||||||||||||||||||||||||    
38564921 ggccgatcgcttttgattcgagatcgggag 38564950  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #18
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 75 - 107
Target Start/End: Original strand, 5459181 - 5459213
Alignment:
75 ggccgatcgcttttgattcgagatcgggagtca 107  Q
    |||||||| ||||||||||||||||||||||||    
5459181 ggccgatcacttttgattcgagatcgggagtca 5459213  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #19
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 53 - 108
Target Start/End: Original strand, 24658926 - 24658982
Alignment:
53 tgatttgtttctagagtttggtgg-ccgatcgcttttgattcgagatcgggagtcag 108  Q
    ||||||| ||||| ||| |||||| || ||| |||||||||||||||||||||||||    
24658926 tgatttggttctaaagtctggtgggccaatcacttttgattcgagatcgggagtcag 24658982  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #20
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 77 - 109
Target Start/End: Original strand, 42374185 - 42374217
Alignment:
77 ccgatcgcttttgattcgagatcgggagtcagt 109  Q
    |||||||||||||||| ||||||||||||||||    
42374185 ccgatcgcttttgatttgagatcgggagtcagt 42374217  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0572 (Bit Score: 47; Significance: 5e-18; HSPs: 1)
Name: scaffold0572
Description:

Target: scaffold0572; HSP #1
Raw Score: 47; E-Value: 5e-18
Query Start/End: Original strand, 8 - 145
Target Start/End: Complemental strand, 6384 - 6247
Alignment:
8 ttaatatgacttctctggtgttctgagagttgagtgatgccttggtgatttgtttctagagtttggtg-gccgatcgcttttgattcgagatcgggagtc 106  Q
    ||||| |||| ||| ||||| || | |||||||| | || ||| |||||||||||||||||| ||||| ||||||| | |||||||||||  ||  ||||    
6384 ttaatgtgacatctttggtggtccgggagttgaggggtgacttagtgatttgtttctagagtctggtgagccgatcacatttgattcgaggacgaaagtc 6285  T
107 agtttcttgactcaagcttttttgcttgttatagtgtct 145  Q
    |||||||||||| ||| ||||| ||||||||||||||||    
6284 agtttcttgacttaag-tttttggcttgttatagtgtct 6247  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0127 (Bit Score: 47; Significance: 5e-18; HSPs: 1)
Name: scaffold0127
Description:

Target: scaffold0127; HSP #1
Raw Score: 47; E-Value: 5e-18
Query Start/End: Original strand, 8 - 145
Target Start/End: Original strand, 31208 - 31345
Alignment:
8 ttaatatgacttctctggtgttctgagagttgagtgatgccttggtgatttgtttctagagtttggtg-gccgatcgcttttgattcgagatcgggagtc 106  Q
    ||||| |||| ||| ||||| || | |||||||| | || ||| |||||||||||||||||| ||||| ||||||| | |||||||||||  ||  ||||    
31208 ttaatgtgacatctttggtggtccgggagttgaggggtgacttagtgatttgtttctagagtctggtgagccgatcacatttgattcgaggacgaaagtc 31307  T
107 agtttcttgactcaagcttttttgcttgttatagtgtct 145  Q
    |||||||||||| ||| ||||| ||||||||||||||||    
31308 agtttcttgacttaag-tttttggcttgttatagtgtct 31345  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3 (Bit Score: 46; Significance: 2e-17; HSPs: 14)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 46; E-Value: 2e-17
Query Start/End: Original strand, 53 - 128
Target Start/End: Original strand, 30127259 - 30127336
Alignment:
53 tgatttgtttctagagtttggtg-gccgatcgcttttgattcgagatcgggagtcagtt-tcttgactcaagcttttt 128  Q
    |||||||||||  |||| ||||| ||||||||||||||||||||||||||||||||||| |||||||||||| |||||    
30127259 tgatttgtttcgggagtctggtgagccgatcgcttttgattcgagatcgggagtcagttctcttgactcaagtttttt 30127336  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #2
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 55 - 122
Target Start/End: Original strand, 19176501 - 19176569
Alignment:
55 atttgtttctagagtttggtgg-ccgatcgcttttgattcgagatcgggagtcagtttcttgactcaag 122  Q
    ||||| ||||| ||| |||||| |||||| |||||||||||||||||||||||||||  ||||||||||    
19176501 atttggttctaaagtctggtgggccgatcacttttgattcgagatcgggagtcagttctttgactcaag 19176569  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #3
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 55 - 122
Target Start/End: Original strand, 43012374 - 43012442
Alignment:
55 atttgtttctagagtttggtggcc-gatcgcttttgattcgagatcgggagtcagtttcttgactcaag 122  Q
    ||||| ||||| ||| |||||||| |||| |||||||||||||||||||||||||||  ||||||||||    
43012374 atttggttctaaagtctggtggcccgatcacttttgattcgagatcgggagtcagttctttgactcaag 43012442  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #4
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 75 - 122
Target Start/End: Original strand, 17550977 - 17551024
Alignment:
75 ggccgatcgcttttgattcgagatcgggagtcagtttcttgactcaag 122  Q
    |||||||| |||||||||||||||||||||||||||  ||||||||||    
17550977 ggccgatcacttttgattcgagatcgggagtcagttctttgactcaag 17551024  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #5
Raw Score: 35; E-Value: 0.00000000008
Query Start/End: Original strand, 53 - 122
Target Start/End: Complemental strand, 23328434 - 23328364
Alignment:
53 tgatttgtttctagagtttggtgg-ccgatcgcttttgattcgagatcgggagtcagtttcttgactcaag 122  Q
    ||||||| ||||| |||||||||| |||||| |||||||||||||||||||||| || || ||| ||||||    
23328434 tgatttggttctaaagtttggtggaccgatcacttttgattcgagatcgggagttagctttttggctcaag 23328364  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #6
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 53 - 109
Target Start/End: Original strand, 31424233 - 31424290
Alignment:
53 tgatttgtttctagagtttggt-ggccgatcgcttttgattcgagatcgggagtcagt 109  Q
    ||||||||||  ||||| |||| ||||| |||||||||||||||||||||||||||||    
31424233 tgatttgttttcagagtctggtaggccggtcgcttttgattcgagatcgggagtcagt 31424290  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #7
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 55 - 107
Target Start/End: Complemental strand, 34475836 - 34475783
Alignment:
55 atttgtttctagagtttggtgg-ccgatcgcttttgattcgagatcgggagtca 107  Q
    ||||||||||| ||| |||||| |||||| ||||||||||||||||||||||||    
34475836 atttgtttctatagtctggtgggccgatcacttttgattcgagatcgggagtca 34475783  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #8
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 78 - 110
Target Start/End: Original strand, 5556593 - 5556625
Alignment:
78 cgatcgcttttgattcgagatcgggagtcagtt 110  Q
    |||||||||||||||||||||||||||||||||    
5556593 cgatcgcttttgattcgagatcgggagtcagtt 5556625  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #9
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 53 - 111
Target Start/End: Complemental strand, 24099411 - 24099352
Alignment:
53 tgatttgtttctagagtttggtgg-ccgatcgcttttgattcgagatcgggagtcagttt 111  Q
    |||||||||| |||||| |||||| |||||| |||||||||||| ||||||| |||||||    
24099411 tgatttgtttatagagtctggtgggccgatcacttttgattcgatatcgggaatcagttt 24099352  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #10
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 75 - 110
Target Start/End: Original strand, 47945726 - 47945761
Alignment:
75 ggccgatcgcttttgattcgagatcgggagtcagtt 110  Q
    |||||||| |||||||||||||||||||||||||||    
47945726 ggccgatcacttttgattcgagatcgggagtcagtt 47945761  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #11
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 75 - 145
Target Start/End: Complemental strand, 19295926 - 19295856
Alignment:
75 ggccgatcgcttttgattcgagatcgggagtcagtttcttgactcaagcttttttgcttgttatagtgtct 145  Q
    |||| ||| |||||||||||| ||||| ||| |||||||||||||||| ||||  ||||||| | ||||||    
19295926 ggcctatcacttttgattcgatatcggaagttagtttcttgactcaagtttttgggcttgttttggtgtct 19295856  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #12
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 78 - 110
Target Start/End: Complemental strand, 9584111 - 9584079
Alignment:
78 cgatcgcttttgattcgagatcgggagtcagtt 110  Q
    ||||| |||||||||||||||||||||||||||    
9584111 cgatcacttttgattcgagatcgggagtcagtt 9584079  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #13
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 34 - 128
Target Start/End: Complemental strand, 24992018 - 24991922
Alignment:
34 gagttgagtgatgccttggtgatttgtttctagagtttggtgg-ccgatcgcttttgattcgagatcgggagt-cagtttcttgactcaagcttttt 128  Q
    |||||||| | | |||| ||||||||||| | || | |||||| |||| ||||||||||||||||| ||||||  ||||| |||||||||| |||||    
24992018 gagttgagaggtaccttagtgatttgtttttggattatggtgggccgaccgcttttgattcgagatagggagtaaagtttgttgactcaagtttttt 24991922  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #14
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 78 - 110
Target Start/End: Complemental strand, 33144007 - 33143975
Alignment:
78 cgatcgcttttgattcgagatcgggagtcagtt 110  Q
    ||||| |||||||||||||||||||||||||||    
33144007 cgatcacttttgattcgagatcgggagtcagtt 33143975  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8 (Bit Score: 44; Significance: 3e-16; HSPs: 10)
Name: chr8
Description:

Target: chr8; HSP #1
Raw Score: 44; E-Value: 3e-16
Query Start/End: Original strand, 67 - 122
Target Start/End: Complemental strand, 16457530 - 16457475
Alignment:
67 agtttggtggccgatcgcttttgattcgagatcgggagtcagtttcttgactcaag 122  Q
    |||||||||||||||| |||||||||||||||||||||||||||  ||||||||||    
16457530 agtttggtggccgatcacttttgattcgagatcgggagtcagttctttgactcaag 16457475  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #2
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 75 - 122
Target Start/End: Complemental strand, 24995456 - 24995409
Alignment:
75 ggccgatcgcttttgattcgagatcgggagtcagtttcttgactcaag 122  Q
    |||||||| |||||||||||||||||||||||||||  ||||||||||    
24995456 ggccgatcacttttgattcgagatcgggagtcagttctttgactcaag 24995409  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #3
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 75 - 122
Target Start/End: Complemental strand, 31207423 - 31207376
Alignment:
75 ggccgatcgcttttgattcgagatcgggagtcagtttcttgactcaag 122  Q
    |||||||| |||||||||||||||||||||||||||  ||||||||||    
31207423 ggccgatcacttttgattcgagatcgggagtcagttctttgactcaag 31207376  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #4
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 78 - 110
Target Start/End: Complemental strand, 30236186 - 30236154
Alignment:
78 cgatcgcttttgattcgagatcgggagtcagtt 110  Q
    |||||||||||||||||||||||||||||||||    
30236186 cgatcgcttttgattcgagatcgggagtcagtt 30236154  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #5
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 75 - 122
Target Start/End: Original strand, 9519519 - 9519566
Alignment:
75 ggccgatcgcttttgattcgagatcgggagtcagtttcttgactcaag 122  Q
    ||||||||  ||||||||||||||||||||||||||  ||||||||||    
9519519 ggccgatcagttttgattcgagatcgggagtcagttctttgactcaag 9519566  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #6
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 75 - 110
Target Start/End: Original strand, 10552288 - 10552323
Alignment:
75 ggccgatcgcttttgattcgagatcgggagtcagtt 110  Q
    ||||||||||||||||||| ||||||||||||||||    
10552288 ggccgatcgcttttgattctagatcgggagtcagtt 10552323  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #7
Raw Score: 30; E-Value: 0.00000007
Query Start/End: Original strand, 45 - 121
Target Start/End: Complemental strand, 16055292 - 16055215
Alignment:
45 tgccttggtgatttgtttctagagtttggtgg-ccgatcgcttttgattcgagatcgggagtcagtttcttgactcaa 121  Q
    ||||| |||||||| |||||||||| |||||| |||||   ||||||||||||||  | |||||||||||| ||||||    
16055292 tgcctcggtgatttttttctagagtctggtgggccgataaattttgattcgagataagaagtcagtttcttaactcaa 16055215  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #8
Raw Score: 30; E-Value: 0.00000007
Query Start/End: Original strand, 85 - 122
Target Start/End: Complemental strand, 37986909 - 37986872
Alignment:
85 ttttgattcgagatcgggagtcagtttcttgactcaag 122  Q
    ||||||||||||||||||||||||||  ||||||||||    
37986909 ttttgattcgagatcgggagtcagttctttgactcaag 37986872  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #9
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 53 - 108
Target Start/End: Complemental strand, 15821463 - 15821407
Alignment:
53 tgatttgtttctagagtttggtggcc-gatcgcttttgattcgagatcgggagtcag 108  Q
    ||||||| ||||| ||| |||||| | |||| |||||||||||||||||||||||||    
15821463 tgatttggttctaaagtctggtgggctgatcacttttgattcgagatcgggagtcag 15821407  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #10
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 78 - 110
Target Start/End: Complemental strand, 17657060 - 17657028
Alignment:
78 cgatcgcttttgattcgagatcgggagtcagtt 110  Q
    ||||| |||||||||||||||||||||||||||    
17657060 cgatcacttttgattcgagatcgggagtcagtt 17657028  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2 (Bit Score: 40; Significance: 0.00000000000008; HSPs: 13)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 40; E-Value: 0.00000000000008
Query Start/End: Original strand, 34 - 120
Target Start/End: Complemental strand, 9560891 - 9560804
Alignment:
34 gagttgagtgatgccttggtgatttgtttctagagtttggtgg-ccgatcgcttttgattcgagatcgggagtcagtttcttgactca 120  Q
    |||||||| | ||||||| |||||||| || | |||||||||| |||||| |||||||||||||||||||||  ||||| ||||||||    
9560891 gagttgaggggtgccttgatgatttgtgtcgaaagtttggtggaccgatcacttttgattcgagatcgggagctagttttttgactca 9560804  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #2
Raw Score: 40; E-Value: 0.00000000000008
Query Start/End: Original strand, 75 - 122
Target Start/End: Complemental strand, 39338926 - 39338879
Alignment:
75 ggccgatcgcttttgattcgagatcgggagtcagtttcttgactcaag 122  Q
    ||||||||||||||||||||||||||||||||||||  ||||||||||    
39338926 ggccgatcgcttttgattcgagatcgggagtcagttctttgactcaag 39338879  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #3
Raw Score: 39; E-Value: 0.0000000000003
Query Start/End: Original strand, 34 - 131
Target Start/End: Original strand, 37830981 - 37831079
Alignment:
34 gagttgagtgatgccttggtgatttgtttctagagtttggtg-gccgatcgcttttgattcgagatcgggagtcagtttcttgactcaagcttttttgc 131  Q
    |||||||| || ||| | |||||||||||||| |||  |||  ||||||| |||||||||||| ||| | |||||||||||||||||||| ||||||||    
37830981 gagttgagggacgccctagtgatttgtttctaaagtcaggtaagccgatcacttttgattcgaaatctgaagtcagtttcttgactcaagtttttttgc 37831079  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #4
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 48 - 108
Target Start/End: Original strand, 14405190 - 14405251
Alignment:
48 cttggtgatttgtttctagagtttggtgg-ccgatcgcttttgattcgagatcgggagtcag 108  Q
    |||| ||||||| ||||| ||| |||||| |||||| |||||||||||||||||||||||||    
14405190 cttgatgatttggttctaaagtctggtgggccgatcacttttgattcgagatcgggagtcag 14405251  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #5
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 55 - 107
Target Start/End: Original strand, 23650384 - 23650437
Alignment:
55 atttgtttctagagtttggtggcc-gatcgcttttgattcgagatcgggagtca 107  Q
    ||||| ||||||||| |||||| | |||||||||||||||||||||||||||||    
23650384 atttggttctagagtctggtgggctgatcgcttttgattcgagatcgggagtca 23650437  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #6
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 45 - 128
Target Start/End: Original strand, 8520391 - 8520475
Alignment:
45 tgccttggtgatttgtttctagagtttggtgg-ccgatcgcttttgattcgagatcgggagtcagtttcttgactcaagcttttt 128  Q
    |||||| |||||||||||||||||| || ||| || ||| |||||||||||||||| | |||| | ||||||||| ||| |||||    
8520391 tgccttagtgatttgtttctagagtctgatggaccaatcacttttgattcgagatcagaagtctgcttcttgactaaagtttttt 8520475  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #7
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 75 - 110
Target Start/End: Original strand, 4471943 - 4471978
Alignment:
75 ggccgatcgcttttgattcgagatcgggagtcagtt 110  Q
    |||||||||| |||||||||||||||||||||||||    
4471943 ggccgatcgcctttgattcgagatcgggagtcagtt 4471978  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #8
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 75 - 110
Target Start/End: Original strand, 16960002 - 16960037
Alignment:
75 ggccgatcgcttttgattcgagatcgggagtcagtt 110  Q
    |||||||||||||||||||||||||| |||||||||    
16960002 ggccgatcgcttttgattcgagatcgagagtcagtt 16960037  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #9
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 75 - 110
Target Start/End: Complemental strand, 22885194 - 22885159
Alignment:
75 ggccgatcgcttttgattcgagatcgggagtcagtt 110  Q
    |||||||| |||||||||||||||||||||||||||    
22885194 ggccgatcacttttgattcgagatcgggagtcagtt 22885159  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #10
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 75 - 110
Target Start/End: Complemental strand, 33788693 - 33788658
Alignment:
75 ggccgatcgcttttgattcgagatcgggagtcagtt 110  Q
    |||||||||||||||||||||||| |||||||||||    
33788693 ggccgatcgcttttgattcgagattgggagtcagtt 33788658  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #11
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 53 - 122
Target Start/End: Original strand, 7874288 - 7874358
Alignment:
53 tgatttgtttctagagtttggtggc-cgatcgcttttgattcgagatcgggagtcagtttcttgactcaag 122  Q
    ||||||| ||||| ||| ||||||  ||||| ||||||||||||||||||||||||| |  ||||||||||    
7874288 tgatttggttctaaagtctggtgggtcgatcacttttgattcgagatcgggagtcagctctttgactcaag 7874358  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #12
Raw Score: 30; E-Value: 0.00000007
Query Start/End: Original strand, 75 - 108
Target Start/End: Original strand, 2062909 - 2062942
Alignment:
75 ggccgatcgcttttgattcgagatcgggagtcag 108  Q
    ||||||| ||||||||||||||||||||||||||    
2062909 ggccgattgcttttgattcgagatcgggagtcag 2062942  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #13
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 75 - 107
Target Start/End: Original strand, 10524117 - 10524149
Alignment:
75 ggccgatcgcttttgattcgagatcgggagtca 107  Q
    |||||||| ||||||||||||||||||||||||    
10524117 ggccgatcacttttgattcgagatcgggagtca 10524149  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0236 (Bit Score: 37; Significance: 0.000000000005; HSPs: 1)
Name: scaffold0236
Description:

Target: scaffold0236; HSP #1
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 85 - 145
Target Start/End: Complemental strand, 10452 - 10392
Alignment:
85 ttttgattcgagatcgggagtcagtttcttgactcaagcttttttgcttgttatagtgtct 145  Q
    |||||||||||||||| ||||||||||||||||||||| | ||| ||||||| | ||||||    
10452 ttttgattcgagatcgagagtcagtttcttgactcaagttgtttggcttgttttggtgtct 10392  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7 (Bit Score: 37; Significance: 0.000000000005; HSPs: 19)
Name: chr7
Description:

Target: chr7; HSP #1
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 67 - 110
Target Start/End: Original strand, 12480897 - 12480941
Alignment:
67 agtttggtgg-ccgatcgcttttgattcgagatcgggagtcagtt 110  Q
    |||||||||| ||||||||||||||||||||||||||||||||||    
12480897 agtttggtgggccgatcgcttttgattcgagatcgggagtcagtt 12480941  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #2
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 75 - 122
Target Start/End: Original strand, 10244202 - 10244249
Alignment:
75 ggccgatcgcttttgattcgagatcgggagtcagtttcttgactcaag 122  Q
    |||||||| |||||||||||||||||||||||||||  ||||||||||    
10244202 ggccgatcacttttgattcgagatcgggagtcagttctttgactcaag 10244249  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #3
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 76 - 109
Target Start/End: Complemental strand, 11379187 - 11379154
Alignment:
76 gccgatcgcttttgattcgagatcgggagtcagt 109  Q
    ||||||||||||||||||||||||||||||||||    
11379187 gccgatcgcttttgattcgagatcgggagtcagt 11379154  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #4
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 53 - 108
Target Start/End: Original strand, 6584906 - 6584962
Alignment:
53 tgatttgtttctagagtttggtgg-ccgatcgcttttgattcgagatcgggagtcag 108  Q
    ||||||| ||||| ||| |||||| |||||| |||||||||||||||||||||||||    
6584906 tgatttggttctaaagtctggtgggccgatcacttttgattcgagatcgggagtcag 6584962  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #5
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 74 - 110
Target Start/End: Complemental strand, 6716798 - 6716762
Alignment:
74 tggccgatcgcttttgattcgagatcgggagtcagtt 110  Q
    ||||||||| |||||||||||||||||||||||||||    
6716798 tggccgatcacttttgattcgagatcgggagtcagtt 6716762  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #6
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 85 - 180
Target Start/End: Original strand, 6718799 - 6718895
Alignment:
85 ttttgattcgagatcgggagtcagtttcttgactcaagcttttttgcttgttatagtgtc-tctatggcacactgggggttgattggtggtggaatt 180  Q
    ||||||||||||||  |||||||||||||||||||||   |||  ||||||||| ||||| ||| ||||| ||||| |||||  |||||||| ||||    
6718799 ttttgattcgagatgaggagtcagtttcttgactcaaatatttgggcttgttatggtgtcttctctggcagactggaggttgcgtggtggtgaaatt 6718895  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #7
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 75 - 119
Target Start/End: Complemental strand, 46262180 - 46262136
Alignment:
75 ggccgatcgcttttgattcgagatcgggagtcagtttcttgactc 119  Q
    |||||||| |||||||||||||||||||||  |||||||||||||    
46262180 ggccgatcacttttgattcgagatcgggagctagtttcttgactc 46262136  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #8
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 75 - 110
Target Start/End: Original strand, 13311859 - 13311894
Alignment:
75 ggccgatcgcttttgattcgagatcgggagtcagtt 110  Q
    |||||||| |||||||||||||||||||||||||||    
13311859 ggccgatcacttttgattcgagatcgggagtcagtt 13311894  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #9
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 75 - 122
Target Start/End: Original strand, 38306281 - 38306328
Alignment:
75 ggccgatcgcttttgattcgagatcgggagtcagtttcttgactcaag 122  Q
    |||||||| ||||||||||||||| |||||||||||  ||||||||||    
38306281 ggccgatcacttttgattcgagattgggagtcagttctttgactcaag 38306328  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #10
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 75 - 122
Target Start/End: Complemental strand, 47325946 - 47325899
Alignment:
75 ggccgatcgcttttgattcgagatcgggagtcagtttcttgactcaag 122  Q
    |||||||||||||||||| ||||||||||||||| |  ||||||||||    
47325946 ggccgatcgcttttgatttgagatcgggagtcagctctttgactcaag 47325899  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #11
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 75 - 109
Target Start/End: Original strand, 38485576 - 38485610
Alignment:
75 ggccgatcgcttttgattcgagatcgggagtcagt 109  Q
    |||||||| ||||||||||||||||||||||||||    
38485576 ggccgatcacttttgattcgagatcgggagtcagt 38485610  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #12
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 76 - 110
Target Start/End: Complemental strand, 46133338 - 46133304
Alignment:
76 gccgatcgcttttgattcgagatcgggagtcagtt 110  Q
    ||||||||||||||||| |||||||||||||||||    
46133338 gccgatcgcttttgatttgagatcgggagtcagtt 46133304  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #13
Raw Score: 30; E-Value: 0.00000007
Query Start/End: Original strand, 53 - 105
Target Start/End: Complemental strand, 26386259 - 26386206
Alignment:
53 tgatttgtttctagagtttggtgg-ccgatcgcttttgattcgagatcgggagt 105  Q
    ||||||| || | ||||| ||||| |||||||||||||||||||||||||||||    
26386259 tgatttgattttggagttcggtggtccgatcgcttttgattcgagatcgggagt 26386206  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #14
Raw Score: 30; E-Value: 0.00000007
Query Start/End: Original strand, 75 - 108
Target Start/End: Original strand, 34389982 - 34390015
Alignment:
75 ggccgatcgcttttgattcgagatcgggagtcag 108  Q
    |||||||| |||||||||||||||||||||||||    
34389982 ggccgatcacttttgattcgagatcgggagtcag 34390015  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #15
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 67 - 110
Target Start/End: Original strand, 3478363 - 3478407
Alignment:
67 agtttggtgg-ccgatcgcttttgattcgagatcgggagtcagtt 110  Q
    |||||||||| |||||| |||||||||||||||||||||| ||||    
3478363 agtttggtgggccgatcacttttgattcgagatcgggagttagtt 3478407  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #16
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 75 - 107
Target Start/End: Complemental strand, 5860349 - 5860317
Alignment:
75 ggccgatcgcttttgattcgagatcgggagtca 107  Q
    |||| ||||||||||||||||||||||||||||    
5860349 ggcctatcgcttttgattcgagatcgggagtca 5860317  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #17
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 75 - 107
Target Start/End: Original strand, 9349769 - 9349801
Alignment:
75 ggccgatcgcttttgattcgagatcgggagtca 107  Q
    |||||||| ||||||||||||||||||||||||    
9349769 ggccgatcacttttgattcgagatcgggagtca 9349801  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #18
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 78 - 110
Target Start/End: Original strand, 33435132 - 33435164
Alignment:
78 cgatcgcttttgattcgagatcgggagtcagtt 110  Q
    ||||| |||||||||||||||||||||||||||    
33435132 cgatcacttttgattcgagatcgggagtcagtt 33435164  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #19
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 78 - 122
Target Start/End: Complemental strand, 48058712 - 48058668
Alignment:
78 cgatcgcttttgattcgagatcgggagtcagtttcttgactcaag 122  Q
    ||||||||||||||| |||||||| ||||||||| ||| ||||||    
48058712 cgatcgcttttgatttgagatcggaagtcagttttttggctcaag 48058668  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5 (Bit Score: 37; Significance: 0.000000000005; HSPs: 9)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 79 - 147
Target Start/End: Complemental strand, 28765659 - 28765591
Alignment:
79 gatcgcttttgattcgagatcgggagtcagtttcttgactcaagcttttttgcttgttatagtgtctct 147  Q
    |||| ||||||||||||||||| ||||||||||||||||| ||| ||||  ||||||||| | ||||||    
28765659 gatcacttttgattcgagatcgagagtcagtttcttgacttaagtttttgggcttgttatggagtctct 28765591  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #2
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 75 - 110
Target Start/End: Original strand, 31721697 - 31721732
Alignment:
75 ggccgatcgcttttgattcgagatcgggagtcagtt 110  Q
    ||||||||||||||||||||||||||||||||||||    
31721697 ggccgatcgcttttgattcgagatcgggagtcagtt 31721732  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #3
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 75 - 110
Target Start/End: Original strand, 34378118 - 34378153
Alignment:
75 ggccgatcgcttttgattcgagatcgggagtcagtt 110  Q
    |||||||| |||||||||||||||||||||||||||    
34378118 ggccgatcacttttgattcgagatcgggagtcagtt 34378153  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #4
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 76 - 110
Target Start/End: Complemental strand, 7195299 - 7195265
Alignment:
76 gccgatcgcttttgattcgagatcgggagtcagtt 110  Q
    ||||||| |||||||||||||||||||||||||||    
7195299 gccgatcacttttgattcgagatcgggagtcagtt 7195265  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #5
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 53 - 110
Target Start/End: Complemental strand, 7392115 - 7392057
Alignment:
53 tgatttgtttctagagtttggtgg-ccgatcgcttttgattcgagatcgggagtcagtt 110  Q
    ||||||| | ||| ||| |||||| |||||| |||||||||||||||||||||||||||    
7392115 tgatttggtcctaaagtctggtggaccgatcacttttgattcgagatcgggagtcagtt 7392057  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #6
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 67 - 119
Target Start/End: Original strand, 12046266 - 12046320
Alignment:
67 agtttggtgg-ccgatcgcttttgattcgagatcgggagtcag-tttcttgactc 119  Q
    |||||||||| |||||| |||||||||||||||||||| |||| |||||||||||    
12046266 agtttggtgggccgatcacttttgattcgagatcgggactcagatttcttgactc 12046320  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #7
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 61 - 110
Target Start/End: Complemental strand, 22675400 - 22675350
Alignment:
61 ttctagagtttggtgg-ccgatcgcttttgattcgagatcgggagtcagtt 110  Q
    ||||| ||| |||||| ||||||| ||||||||||||||||||||||||||    
22675400 ttctaaagtctggtggaccgatcgattttgattcgagatcgggagtcagtt 22675350  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #8
Raw Score: 30; E-Value: 0.00000007
Query Start/End: Original strand, 67 - 107
Target Start/End: Complemental strand, 39024520 - 39024479
Alignment:
67 agtttggtggc-cgatcgcttttgattcgagatcgggagtca 107  Q
    ||||||||||| | ||||||||||||||||||||||||||||    
39024520 agtttggtggctcaatcgcttttgattcgagatcgggagtca 39024479  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #9
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 75 - 107
Target Start/End: Complemental strand, 13954295 - 13954263
Alignment:
75 ggccgatcgcttttgattcgagatcgggagtca 107  Q
    |||||||| ||||||||||||||||||||||||    
13954295 ggccgatcacttttgattcgagatcgggagtca 13954263  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold1613 (Bit Score: 36; Significance: 0.00000000002; HSPs: 1)
Name: scaffold1613
Description:

Target: scaffold1613; HSP #1
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 75 - 110
Target Start/End: Complemental strand, 1078 - 1043
Alignment:
75 ggccgatcgcttttgattcgagatcgggagtcagtt 110  Q
    ||||||||||||||||||||||||||||||||||||    
1078 ggccgatcgcttttgattcgagatcgggagtcagtt 1043  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0267 (Bit Score: 35; Significance: 0.00000000008; HSPs: 1)
Name: scaffold0267
Description:

Target: scaffold0267; HSP #1
Raw Score: 35; E-Value: 0.00000000008
Query Start/End: Original strand, 75 - 145
Target Start/End: Complemental strand, 9183 - 9113
Alignment:
75 ggccgatcgcttttgattcgagatcgggagtcagtttcttgactcaagcttttttgcttgttatagtgtct 145  Q
    |||| |||||||||||||| |||| |||||||||||||| |||||||| ||||   |||||||| ||||||    
9183 ggccaatcgcttttgattcaagattgggagtcagtttctagactcaagtttttggacttgttatggtgtct 9113  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0068 (Bit Score: 29; Significance: 0.0000003; HSPs: 1)
Name: scaffold0068
Description:

Target: scaffold0068; HSP #1
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 75 - 107
Target Start/End: Complemental strand, 35832 - 35800
Alignment:
75 ggccgatcgcttttgattcgagatcgggagtca 107  Q
    |||||||| ||||||||||||||||||||||||    
35832 ggccgatcacttttgattcgagatcgggagtca 35800  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University