View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF3648_high_57 (Length: 215)

Name: NF3648_high_57
Description: NF3648
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF3648_high_57
NF3648_high_57
[»] chr3 (1 HSPs)
chr3 (115-197)||(54880582-54880664)


Alignment Details
Target: chr3 (Bit Score: 83; Significance: 2e-39; HSPs: 1)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 83; E-Value: 2e-39
Query Start/End: Original strand, 115 - 197
Target Start/End: Complemental strand, 54880664 - 54880582
Alignment:
115 agatgggaaagtaaaagaaaggggacaaaagaattatgggcgaattggcattagggtccagaaacatcagctccactaggctc 197  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
54880664 agatgggaaagtaaaagaaaggggacaaaagaattatgggcgaattggcattagggtccagaaacatcagctccactaggctc 54880582  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University