View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3648_low_19 (Length: 375)
Name: NF3648_low_19
Description: NF3648
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3648_low_19 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 291; Significance: 1e-163; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 291; E-Value: 1e-163
Query Start/End: Original strand, 1 - 332
Target Start/End: Original strand, 32682966 - 32683297
Alignment:
| Q |
1 |
caacaaagaatcaatcacctacctagtcacatgcactattatgttcattttcatctaagtacctgcacgtcctagtaatttccatccaagtattattgtc |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||| ||||||||||||||| |||||||||||||||||| |
|
|
| T |
32682966 |
caacaaagaatcaatcacctacctagtcacatgcactattatgatcattttcatctaagtacctgaacgtcctagtaattttcatccaagtattattgtc |
32683065 |
T |
 |
| Q |
101 |
atttatttctgcaaacagaaatttacattcagaagtaaagtaacttgttgcttgctcatacatgcaaatgggacagatagatttgtctttctcacatgac |
200 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
32683066 |
atttatttctgcaaacagaaatttacattcagaagcaaagtaacttgttgcttgctcatacatgcaaatgggacagatagatttgtctttctcacgtgac |
32683165 |
T |
 |
| Q |
201 |
tgtaacannnnnnnacatgtgcaagttttagatatgggagggccaccaccatattcatgctatcattggtaatagatcaatcatggtgctgttaaaggtt |
300 |
Q |
| |
|
||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32683166 |
tgtaacatttttttacatgtgcaagttttagatatgggagggccaccaccatattcatgctatcattggtaatagatcaatcatggtgctgttaaaggtt |
32683265 |
T |
 |
| Q |
301 |
tttccaagagtagtggtggtgttaaatcccct |
332 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |
|
|
| T |
32683266 |
tttccaagagtagtggtggtgttaaatcccct |
32683297 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University