View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3648_low_27 (Length: 344)
Name: NF3648_low_27
Description: NF3648
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3648_low_27 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 277; Significance: 1e-155; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 277; E-Value: 1e-155
Query Start/End: Original strand, 20 - 327
Target Start/End: Original strand, 10976439 - 10976747
Alignment:
| Q |
20 |
tcaagcataatggaccaaggtaaa-tatttatatagttgaataaaatatgaaacaacaatacctgaatgttttcgatctcttcggcgatcatagacatac |
118 |
Q |
| |
|
|||||||||||||||||||||||| || |||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
10976439 |
tcaagcataatggaccaaggtaaaatagttatatagatgaataaaatatgaaacaacaatacctgaatgttttcgatctcttcggcgatcatagacatac |
10976538 |
T |
|
| Q |
119 |
catagtcacatagtttgggaaagcgatgttcgtcaagtaaaacattgtttgtctttaatttgtttctaaaacaacctggtataattccagtatgtaaaaa |
218 |
Q |
| |
|
||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
10976539 |
catagtcacttagtttgggaaagcgatgttcgtcaagtaaaacattgtttgtctttaatttgtttctaaaacaacctggtataattccagtatgtaaaaa |
10976638 |
T |
|
| Q |
219 |
atgcaccgccttggcaactccgattaaaattgctaatctatcagaccattttagtgccttatccaatgaaaattctgcatgtttaaataaagcaagatta |
318 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||| |||||||||||||||||||||||||||||||||| |
|
|
| T |
10976639 |
atgcaccgccttggcaactccgattaaaattgctaatctatcagaccattttagagccttatccggtgaaaattctgcatgtttaaataaagcaagatta |
10976738 |
T |
|
| Q |
319 |
gtattttag |
327 |
Q |
| |
|
||||||||| |
|
|
| T |
10976739 |
gtattttag |
10976747 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6 (Bit Score: 58; Significance: 2e-24; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 58; E-Value: 2e-24
Query Start/End: Original strand, 115 - 260
Target Start/End: Complemental strand, 8168076 - 8167931
Alignment:
| Q |
115 |
ataccatagtcacatagtttgggaaagcgatgttcgtcaagtaaaacattgtttgtctttaatttgtttctaaaacaacctggtataattccagtatgta |
214 |
Q |
| |
|
||||||||||||| |||||| |||| || ||||| |||||||| ||| | |||||||||| || ||| |||||||| |||||||||| |||||||||| |
|
|
| T |
8168076 |
ataccatagtcacttagttttggaatgcagtgttcatcaagtaacacactctttgtctttagttggttgctaaaacatcctggtataacaccagtatgta |
8167977 |
T |
|
| Q |
215 |
aaaaatgcaccgccttggcaactccgattaaaattgctaatctatc |
260 |
Q |
| |
|
| |||||||| ||||| |||||||| || |||||||| | |||||| |
|
|
| T |
8167976 |
agaaatgcactgcctttgcaactccaatcaaaattgccagtctatc |
8167931 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University