View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3648_low_29 (Length: 325)
Name: NF3648_low_29
Description: NF3648
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3648_low_29 |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 290; Significance: 1e-163; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 290; E-Value: 1e-163
Query Start/End: Original strand, 18 - 315
Target Start/End: Original strand, 29447698 - 29447995
Alignment:
| Q |
18 |
taactaaccttttcaatgacttaactctatccatcgttgccatgttttgtactgaagattgaaccctagtcgcatttcttaattcttctcttgataccat |
117 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
29447698 |
taactaaccttttcaatgacttaactctatccatcgttgccatgttttgtactgaaggttgaaccctagtcgcatttcttaattcttctcttgataccat |
29447797 |
T |
 |
| Q |
118 |
cggtgtattaatatgctttagtgtatccacgtcttttgcagattcggcattagtatgaagcccacatttcttatatactgcatgactctgactcaatgat |
217 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
29447798 |
cggtgtattaatatgctttagtgtatccacgtcttttgcagattcggcattagtatgaagcccacatttcttatatactgcatgactctgactcaatgat |
29447897 |
T |
 |
| Q |
218 |
tcatttcgagccaaaaatggtttcccaactgcattttctggaatcaaattttcacctttagaacttgaattacatgtgtgctgattcattaacctatg |
315 |
Q |
| |
|
|||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
29447898 |
tcatttcgagccaaaaatggtttctcaactgcattttctggaatcaaattttcacctttagaacttgaattacatgtgtgctgattcattaacctatg |
29447995 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University