View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3648_low_40 (Length: 250)
Name: NF3648_low_40
Description: NF3648
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3648_low_40 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 82; Significance: 8e-39; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 82; E-Value: 8e-39
Query Start/End: Original strand, 130 - 236
Target Start/End: Complemental strand, 6510871 - 6510769
Alignment:
| Q |
130 |
ctcaatatatgtctaagcatatgacgaaacaaccattcaataattttatttgtttcttcacaagtaaacttactcaatattaattgtttgtggggtctta |
229 |
Q |
| |
|
||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||| || |
|
|
| T |
6510871 |
ctcaatatatgtctaagcatatgaccaaacaaccattcaataattttatttgtttcttcacaagtaaacttactcaat----attgtttgtggggtccta |
6510776 |
T |
|
| Q |
230 |
acttgat |
236 |
Q |
| |
|
||||||| |
|
|
| T |
6510775 |
acttgat |
6510769 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 48; E-Value: 2e-18
Query Start/End: Original strand, 18 - 65
Target Start/End: Complemental strand, 6510974 - 6510927
Alignment:
| Q |
18 |
aaattactcaagacacatgattatctatggattatatttctccacgag |
65 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6510974 |
aaattactcaagacacatgattatctatggattatatttctccacgag |
6510927 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University