View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3648_low_42 (Length: 248)
Name: NF3648_low_42
Description: NF3648
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3648_low_42 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 139; Significance: 8e-73; HSPs: 3)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 139; E-Value: 8e-73
Query Start/End: Original strand, 62 - 212
Target Start/End: Complemental strand, 21035913 - 21035763
Alignment:
| Q |
62 |
ttccctctctctgctttcagagaaaatccagaaaatggagaacacagcattgaaaaaccttgatcacgatgaacacgaagaagaaatccccgattccttt |
161 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||| ||||||||| |
|
|
| T |
21035913 |
ttccctctctctgctttcagagaaaatccagaaaatggagaacacagcattgaaaaaccttgatcacgatgaacatgaagaagaaatcccagattccttt |
21035814 |
T |
|
| Q |
162 |
tgttgctgcgtttgtctgtaagtttctctcaccatctttcaattctatgcc |
212 |
Q |
| |
|
||||| ||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
21035813 |
tgttgttgcgtttgtctgtaagtttctctcaccatctttcaattctatgcc |
21035763 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 100; E-Value: 1e-49
Query Start/End: Original strand, 90 - 209
Target Start/End: Complemental strand, 21050931 - 21050812
Alignment:
| Q |
90 |
cagaaaatggagaacacagcattgaaaaaccttgatcacgatgaacacgaagaagaaatccccgattccttttgttgctgcgtttgtctgtaagtttctc |
189 |
Q |
| |
|
|||||||||||||||||| |||||||| || |||||||||||||||| ||||||||||||||||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
21050931 |
cagaaaatggagaacacaacattgaaacacgttgatcacgatgaacatgaagaagaaatccccgattccttttgttgttgcgtttgtctgtaagtttctc |
21050832 |
T |
|
| Q |
190 |
tcaccatctttcaattctat |
209 |
Q |
| |
|
|||||||||||||||||||| |
|
|
| T |
21050831 |
tcaccatctttcaattctat |
21050812 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #3
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 11 - 43
Target Start/End: Complemental strand, 21035962 - 21035930
Alignment:
| Q |
11 |
ttcttagattctaaattccctctctctcttctc |
43 |
Q |
| |
|
|||||||||||||||||||||||||||| |||| |
|
|
| T |
21035962 |
ttcttagattctaaattccctctctctcctctc |
21035930 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University