View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3648_low_48 (Length: 238)
Name: NF3648_low_48
Description: NF3648
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3648_low_48 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 142; Significance: 1e-74; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 142; E-Value: 1e-74
Query Start/End: Original strand, 20 - 220
Target Start/End: Original strand, 24258767 - 24258980
Alignment:
| Q |
20 |
atattacaaaacaatcaaaccaaagattgnnnnnnncatcatttgtatcattgtaataaataagaagaaaagtatactatagtatagtgatgaagtggta |
119 |
Q |
| |
|
||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
24258767 |
atattacaaaacaatcaaaccaaagattgaaaaaa-catcatttgtatcattgtaataaataagaagaaaagtatactatagtatagtgatgaagtggta |
24258865 |
T |
 |
| Q |
120 |
gtgaacaagag--------------agagagattcatatgaagagaaacgaggattgtggaagaaagagtcaacaacctgggaaagccgggagagttttt |
205 |
Q |
| |
|
||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
24258866 |
gtgaacaagagagagagagagagagagagagattcatatgaagagaaacgaggattgtggaagaaagagtcaacaacctgggaaagccgggagagttttt |
24258965 |
T |
 |
| Q |
206 |
gttggatggtatatt |
220 |
Q |
| |
|
||||||||||||||| |
|
|
| T |
24258966 |
gttggatggtatatt |
24258980 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University