View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF3648_low_52 (Length: 231)

Name: NF3648_low_52
Description: NF3648
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF3648_low_52
NF3648_low_52
[»] chr2 (1 HSPs)
chr2 (151-213)||(1539714-1539776)


Alignment Details
Target: chr2 (Bit Score: 59; Significance: 4e-25; HSPs: 1)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 59; E-Value: 4e-25
Query Start/End: Original strand, 151 - 213
Target Start/End: Complemental strand, 1539776 - 1539714
Alignment:
151 atcctaggtttgtgatatgacagtgatgaataattgtttttgtttacagtgtctatcgcccct 213  Q
    ||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||    
1539776 atcctaggtttgtgacatgacagtgatgaataattgtttttgtttacagtgtctatcgcccct 1539714  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University