View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3648_low_59 (Length: 217)
Name: NF3648_low_59
Description: NF3648
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3648_low_59 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 91; Significance: 3e-44; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 91; E-Value: 3e-44
Query Start/End: Original strand, 93 - 203
Target Start/End: Original strand, 9499594 - 9499704
Alignment:
| Q |
93 |
ggtctctgccacggtagttggttgcaccgattttgggtagctaaatgtagccgctgcccaacacatccaaggagtgatgcgtgaccgttatttcatcagg |
192 |
Q |
| |
|
||||||||||||||||||||||||||| |||||||||||||||||||||||||||| |||| ||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
9499594 |
ggtctctgccacggtagttggttgcactgattttgggtagctaaatgtagccgctgtccaatgcatccaaggagtggtgcgtgaccgttatttcatcagg |
9499693 |
T |
 |
| Q |
193 |
catgtaaaatg |
203 |
Q |
| |
|
||||||||||| |
|
|
| T |
9499694 |
catgtaaaatg |
9499704 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 45; E-Value: 8e-17
Query Start/End: Original strand, 15 - 59
Target Start/End: Original strand, 9499552 - 9499596
Alignment:
| Q |
15 |
ataattctaagtgaaacagctgtgtttagatttaccgtatttggt |
59 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
9499552 |
ataattctaagtgaaacagctgtgtttagatttaccgtatttggt |
9499596 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University