View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3649_high_6 (Length: 250)
Name: NF3649_high_6
Description: NF3649
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3649_high_6 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 100; Significance: 1e-49; HSPs: 3)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 100; E-Value: 1e-49
Query Start/End: Original strand, 123 - 233
Target Start/End: Complemental strand, 8238722 - 8238611
Alignment:
| Q |
123 |
atccgtcgtgagtacaacttgtgcatctttt-atttggactagaaaaattgcttaccactatttgaagccactatgaaatcaaggataattttgtaaata |
221 |
Q |
| |
|
|||| |||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
8238722 |
atccatcgtgagtacaacttgtgcatctttttatttggactagaaaaattgcttaccactatttgaagccactatgaaatcaaggataattttgtaaata |
8238623 |
T |
 |
| Q |
222 |
ttaatcaaagtt |
233 |
Q |
| |
|
|||||||||||| |
|
|
| T |
8238622 |
ttaatcaaagtt |
8238611 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 53; E-Value: 2e-21
Query Start/End: Original strand, 2 - 54
Target Start/End: Complemental strand, 8238867 - 8238815
Alignment:
| Q |
2 |
tatttcccttgctcggttgggtagggttcttcttggttttatggtgtcaagag |
54 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
8238867 |
tatttcccttgctcggttgggtagggttcttcttggttttatggtgtcaagag |
8238815 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #3
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 179 - 220
Target Start/End: Original strand, 45411765 - 45411806
Alignment:
| Q |
179 |
actatttgaagccactatgaaatcaaggataattttgtaaat |
220 |
Q |
| |
|
||||||||||| ||||||||||||||| |||||||| ||||| |
|
|
| T |
45411765 |
actatttgaagtcactatgaaatcaagaataattttttaaat |
45411806 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University