View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF3649_low_12 (Length: 250)

Name: NF3649_low_12
Description: NF3649
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF3649_low_12
NF3649_low_12
[»] chr2 (3 HSPs)
chr2 (123-233)||(8238611-8238722)
chr2 (2-54)||(8238815-8238867)
chr2 (179-220)||(45411765-45411806)


Alignment Details
Target: chr2 (Bit Score: 100; Significance: 1e-49; HSPs: 3)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 100; E-Value: 1e-49
Query Start/End: Original strand, 123 - 233
Target Start/End: Complemental strand, 8238722 - 8238611
Alignment:
123 atccgtcgtgagtacaacttgtgcatctttt-atttggactagaaaaattgcttaccactatttgaagccactatgaaatcaaggataattttgtaaata 221  Q
    |||| |||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
8238722 atccatcgtgagtacaacttgtgcatctttttatttggactagaaaaattgcttaccactatttgaagccactatgaaatcaaggataattttgtaaata 8238623  T
222 ttaatcaaagtt 233  Q
    ||||||||||||    
8238622 ttaatcaaagtt 8238611  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #2
Raw Score: 53; E-Value: 2e-21
Query Start/End: Original strand, 2 - 54
Target Start/End: Complemental strand, 8238867 - 8238815
Alignment:
2 tatttcccttgctcggttgggtagggttcttcttggttttatggtgtcaagag 54  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||    
8238867 tatttcccttgctcggttgggtagggttcttcttggttttatggtgtcaagag 8238815  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #3
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 179 - 220
Target Start/End: Original strand, 45411765 - 45411806
Alignment:
179 actatttgaagccactatgaaatcaaggataattttgtaaat 220  Q
    ||||||||||| ||||||||||||||| |||||||| |||||    
45411765 actatttgaagtcactatgaaatcaagaataattttttaaat 45411806  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University