View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3650_high_3 (Length: 527)
Name: NF3650_high_3
Description: NF3650
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3650_high_3 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 190; Significance: 1e-103; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 190; E-Value: 1e-103
Query Start/End: Original strand, 62 - 276
Target Start/End: Original strand, 25731067 - 25731283
Alignment:
| Q |
62 |
tttggtggattcctgttttggttatattggcctcagtttgctcttttgattatcacatgggcg--acaacaatccttaatttttatgatatgttatttct |
159 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||| |
|
|
| T |
25731067 |
tttggtggattcctgttttggttatattggcctcagtttgctcttttgattatcacatgggcgcgacaacaatccttaatttttatgatatgttatttcc |
25731166 |
T |
 |
| Q |
160 |
ttttcggatgttgcgaatgtcacctctcatgaattagaacatcctgtgcgtgattcagcttctattctcctgcattattggaatactggtattttatgta |
259 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||| ||||||||||| |
|
|
| T |
25731167 |
ttttcggatgttgcgaatgtcacctctcatgaattagaacatcctgtgcgtgattcagcttccattctcctgcattattggaatactgctattttatgta |
25731266 |
T |
 |
| Q |
260 |
tccatatccatgtcatt |
276 |
Q |
| |
|
||||||||||| ||||| |
|
|
| T |
25731267 |
tccatatccatatcatt |
25731283 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 165; E-Value: 5e-88
Query Start/End: Original strand, 327 - 510
Target Start/End: Original strand, 25731327 - 25731511
Alignment:
| Q |
327 |
tcccttacgtgatttggtgcattgagttttttgagaaaattaaggaatagtttcaggaccgaaattatataaatagaggatctgtgtagatgttttttca |
426 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
25731327 |
tcccttacgtgatttggtgcattgagttttttgagaaaattaaggaatagtttcaggaccaaaattatataaatataggatctgtgtagatgttttttca |
25731426 |
T |
 |
| Q |
427 |
tcaccaaatgcgatacaacctgtatagc-ttgcatcacaaaagtactacaatttccttactctttttctcatcatgtctacttct |
510 |
Q |
| |
|
|||||||||||||||||||||||||||| |||||| ||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
25731427 |
tcaccaaatgcgatacaacctgtatagcattgcattacaaaagtactacaatttccttactctttttctcatcatgtctacttct |
25731511 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University