View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3650_low_20 (Length: 229)
Name: NF3650_low_20
Description: NF3650
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3650_low_20 |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 201; Significance: 1e-110; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 201; E-Value: 1e-110
Query Start/End: Original strand, 1 - 216
Target Start/End: Original strand, 27099469 - 27099685
Alignment:
| Q |
1 |
ctaaacttttaatttggtattttctatttaaaaagaattaaaaatagcattgaaatttaaaccatttaatcttgatccaacgaccacgaatgtattgtct |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||| |
|
|
| T |
27099469 |
ctaaacttttaatttggtattttctatttaaaaagaattaaaaatagcattgaaatttaaaccatttaatcttaatccaacgaccacgaatgtattgtct |
27099568 |
T |
 |
| Q |
101 |
acatgaatgtttcaaaattttgatggaagg-aaataccattccttgaaggaggtcatattaattttgaaatgacatgaaagggtgtggttggataggata |
199 |
Q |
| |
|
||||||||| |||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
27099569 |
acatgaatgcttcaaaattttgatggaaggaaaataccattccttgaaggaggtcatattaattttgaaatgacatgaaagggtgtggttggataggata |
27099668 |
T |
 |
| Q |
200 |
tttacagtgttccccat |
216 |
Q |
| |
|
||||||||||||||||| |
|
|
| T |
27099669 |
tttacagtgttccccat |
27099685 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University