View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3650_low_8 (Length: 380)
Name: NF3650_low_8
Description: NF3650
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3650_low_8 |
 | |
|
Alignment Details
Target: chr6 (Bit Score: 220; Significance: 1e-121; HSPs: 2)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 220; E-Value: 1e-121
Query Start/End: Original strand, 10 - 281
Target Start/End: Complemental strand, 32869038 - 32868768
Alignment:
| Q |
10 |
ggtggcgatgatggcggacgtcttggtagaaaagcattagaccgcgatagaaaagcacaaggcagatgtccttgttgcggtaatggtcacaatcacaaca |
109 |
Q |
| |
|
||||| ||||||||| ||||||||||||||||||||||||||||||||||||||| || ||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32869038 |
ggtggtgatgatggcagacgtcttggtagaaaagcattagaccgcgatagaaaaggacgaggcagatgtccttgttgcggtaatggtcacaatcacaaca |
32868939 |
T |
|
| Q |
110 |
caaaatcagcatcagataaacaaggtttgctataatttgaaactcgcaaatctatagataataataaaagcaagctttgtattatagcaagtatgacatt |
209 |
Q |
| |
|
|||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||| |||||||||||||||||||||| |
|
|
| T |
32868938 |
caaaataagcatcagataaacaaggtttgctataatttgaaactcgcaaatctatagataataat-aaagcaagcttagtattatagcaagtatgacatt |
32868840 |
T |
|
| Q |
210 |
tgccgtctaattaaagtgtttactttttctaatctttctattttggcgttgaatattgactttagttttctt |
281 |
Q |
| |
|
|| |||||||||| |||||||||||||||||||||||||||||||| ||||||||||||| || |||||||| |
|
|
| T |
32868839 |
tgtcgtctaattagagtgtttactttttctaatctttctattttggtgttgaatattgacattggttttctt |
32868768 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 56; E-Value: 4e-23
Query Start/End: Original strand, 307 - 366
Target Start/End: Complemental strand, 32868773 - 32868714
Alignment:
| Q |
307 |
tttcttcaattttttgggacgcatcttaactgaaatctggtatcttcctatgtagatatt |
366 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||| |
|
|
| T |
32868773 |
tttcttcaattttttgggacgcatcttaactgaaatctggtatcttcctatgtggatatt |
32868714 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 34; Significance: 0.0000000005; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 34; E-Value: 0.0000000005
Query Start/End: Original strand, 162 - 211
Target Start/End: Complemental strand, 7964565 - 7964517
Alignment:
| Q |
162 |
tatagataataataaaagcaagctttgtattatagcaagtatgacatttg |
211 |
Q |
| |
|
|||||||||||||||| |||||||| ||||||| |||||||||||||||| |
|
|
| T |
7964565 |
tatagataataataaa-gcaagcttagtattatggcaagtatgacatttg |
7964517 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University