View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3651_high_13 (Length: 371)
Name: NF3651_high_13
Description: NF3651
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3651_high_13 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 307; Significance: 1e-173; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 307; E-Value: 1e-173
Query Start/End: Original strand, 9 - 354
Target Start/End: Complemental strand, 44646223 - 44645875
Alignment:
| Q |
9 |
gttaccttcccattcatttaatttccgtgtttcagcaaagaaaggactccatcatggaatgcatcacaacaggcatgcaaaggagtttgaaaaagtattg |
108 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||| ||||||||||||||||||||||||| || |
|
|
| T |
44646223 |
gttaccttcccattcatttaatttccgtgtttcagcaaagaaaggacaccatcatggaatgcatcacaaccagcatgcaaaggagtttgaaaaagtactg |
44646124 |
T |
 |
| Q |
109 |
gaagagaagaaagggat---atcaaagaatgaacaagtcagttcgaaagacgaacacggtgaaacttggaggaggagcaaccaccggaacaaagaagaaa |
205 |
Q |
| |
|
||||||||||||||||| |||||||||| |||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44646123 |
gaagagaagaaagggatcatatcaaagaataaacaagtcaggtcgaaagacgaacacggtgaaacttggaggaggagcaaccaccggaacaaagaagaaa |
44646024 |
T |
 |
| Q |
206 |
tggaggatcaaaatttctcctaagataaaatttccaacaatttcttctcctaagaaatggatggtgtggatgagagactcctatgtgaggatgatgcttg |
305 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44646023 |
tggaggatcaaaatttctcctaagataaaatttccaacaatttcttctcctaagaaatggatggtgtggatgagagactcctatgtgaggatgatgcttg |
44645924 |
T |
 |
| Q |
306 |
gtttggctaactcaaaggtaatgaatttgactagcttcaatgaccccac |
354 |
Q |
| |
|
||||||||||||| ||||||||||||||||||||||||||||||||||| |
|
|
| T |
44645923 |
gtttggctaactcgaaggtaatgaatttgactagcttcaatgaccccac |
44645875 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University