View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3651_high_21 (Length: 287)
Name: NF3651_high_21
Description: NF3651
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3651_high_21 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 150; Significance: 2e-79; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 150; E-Value: 2e-79
Query Start/End: Original strand, 1 - 166
Target Start/End: Original strand, 13887070 - 13887235
Alignment:
| Q |
1 |
gtaagaaagtgagtctcctcgaatttgggtatgtataatcactctagtttggttgttgctagttttgctccacatatcactagacactttgtattcattt |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||| ||||||||| ||| |||||||||||||||||||||||||||||||||||||| |
|
|
| T |
13887070 |
gtaagaaagtgagtctcctcgaatttgggtatgtataatcactctaggttggttgtttctaattttgctccacatatcactagacactttgtattcattt |
13887169 |
T |
|
| Q |
101 |
caacaatatctggcatatgcaagtgttcaatgtgtcttcaaactccttctttcaatgcagttttta |
166 |
Q |
| |
|
|||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||| |
|
|
| T |
13887170 |
caacaatatctggcatatgcaagtgttcaacgtgtcttcaaactccttctttcaatgcagttttta |
13887235 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University