View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3651_high_22 (Length: 285)
Name: NF3651_high_22
Description: NF3651
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3651_high_22 |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 228; Significance: 1e-126; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 228; E-Value: 1e-126
Query Start/End: Original strand, 2 - 270
Target Start/End: Complemental strand, 32949716 - 32949449
Alignment:
| Q |
2 |
agaataaagtttgtttgttgtataaacttttgataaggattttcattggtcattgtctacgcacacgtttttctcttttcttcaacataaaaatccatgc |
101 |
Q |
| |
|
||||||||||||| ||||||||||||||||||||||| ||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32949716 |
agaataaagtttggttgttgtataaacttttgataagttttttcattggtcatt-tctacgcacacgtttttctcttttcttcaacataaaaatccatgc |
32949618 |
T |
 |
| Q |
102 |
acatcnnnnnnnagtgttgctaaaagccttaacttctgtggtgttataaagtatgctctcttttctctttttgtattagctgatatcaatatttgaaatg |
201 |
Q |
| |
|
||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32949617 |
acatctttttttagtgttgctaaaagccttaacttctgtggtgttataaagtatgctctcttttctctttttgtattagctgatatcaatatttgaaatg |
32949518 |
T |
 |
| Q |
202 |
attctagatttcatctgttgtaaatttgtcattatacaattgtttgtcaaaatctcttttagtatatat |
270 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32949517 |
attctagatttcatctgttgtaaatttgtcattatacaattgtttgtcaaaatctcttttagtatatat |
32949449 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University