View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3651_high_24 (Length: 251)
Name: NF3651_high_24
Description: NF3651
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3651_high_24 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 135; Significance: 2e-70; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 135; E-Value: 2e-70
Query Start/End: Original strand, 89 - 239
Target Start/End: Complemental strand, 49109257 - 49109107
Alignment:
| Q |
89 |
agaggtcctaaataatattaactagtattttagtaactatactcttatgcttattacaaggatcaaggatgtattagggtatccttgataaagcttatca |
188 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||| ||| |
|
|
| T |
49109257 |
agaggtcctaaataatattaactagtattttagtaactatactcttatgcttattacaaggatcaaggatgtatctgggtatccttgataaagcttgtca |
49109158 |
T |
 |
| Q |
189 |
gttggaaggcaaaatatattgctttaggagtatcgacacattacttgccta |
239 |
Q |
| |
|
||||||||||||||||||||||||||||||| ||||||||||||||||||| |
|
|
| T |
49109157 |
gttggaaggcaaaatatattgctttaggagtctcgacacattacttgccta |
49109107 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 45; E-Value: 1e-16
Query Start/End: Original strand, 1 - 45
Target Start/End: Complemental strand, 49109346 - 49109302
Alignment:
| Q |
1 |
tagtactaatttctaattactatttctcctctcttttcatctgta |
45 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
49109346 |
tagtactaatttctaattactatttctcctctcttttcatctgta |
49109302 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University