View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3651_high_27 (Length: 247)
Name: NF3651_high_27
Description: NF3651
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3651_high_27 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 214; Significance: 1e-117; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 214; E-Value: 1e-117
Query Start/End: Original strand, 11 - 228
Target Start/End: Complemental strand, 3303352 - 3303135
Alignment:
| Q |
11 |
catcatcagttgtatgtgaccttgtgaatatgatttagaggtcattttgcttatctatgttattacttattttctatcaggcatgtgcgtgagtgtttaa |
110 |
Q |
| |
|
|||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3303352 |
catcatgagttgtatgtgaccttgtgaatatgatttagaggtcattttgcttatctatgttattacttattttctatcaggcatgtgcgtgagtgtttaa |
3303253 |
T |
 |
| Q |
111 |
ggtaacattttgaattttaagaaggaacttagaatctgtgccacaatcctattattatcattcacccactctcaagtctcaaccctaggtaaatattgat |
210 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3303252 |
ggtaacattttgaattttaagaaggaacttagaatctgtgccacaatcctattattatcattcacccactctcaagtctcaaccctaggtaaatattgat |
3303153 |
T |
 |
| Q |
211 |
tttgacaacattgatagc |
228 |
Q |
| |
|
|||||||||||||||||| |
|
|
| T |
3303152 |
tttgacaacattgatagc |
3303135 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University