View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3651_high_32 (Length: 235)
Name: NF3651_high_32
Description: NF3651
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3651_high_32 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 91; Significance: 3e-44; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 91; E-Value: 3e-44
Query Start/End: Original strand, 15 - 113
Target Start/End: Original strand, 48518388 - 48518486
Alignment:
| Q |
15 |
caaaggcaaggatgggttctactaagttctaggtggagaaattcaagaacaataatgattccagtctttggagaatgaagatgaggactttcttggtta |
113 |
Q |
| |
|
|||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||| |
|
|
| T |
48518388 |
caaaggcaaggacgggttctactaagttctaggtggagaaattcaagaacaataatgattccagtctttggagaatgaagatgaggattttcttggtta |
48518486 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University