View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3651_low_10 (Length: 400)
Name: NF3651_low_10
Description: NF3651
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3651_low_10 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 318; Significance: 1e-179; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 318; E-Value: 1e-179
Query Start/End: Original strand, 1 - 366
Target Start/End: Complemental strand, 5750879 - 5750507
Alignment:
| Q |
1 |
cggagtttgttacgattggtttggttcagaggttcacgagagggttcagatgtagaagatgagggtaaaatgggaatttgaggtcaagggattttgaggc |
100 |
Q |
| |
|
||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
5750879 |
cggagtttgttacgattggtttggttcggaggttcacgagagggttcagatgtagaagatgagggtaaaatgggaatttgaggtcaagggattttgaggc |
5750780 |
T |
 |
| Q |
101 |
tttggaaattaggatgaaggagaggggaaaaggaaaattgggaagggtggtgcgcgtgaaacagaaatggtggaatttgtcacgcgcttaacgcgtgatt |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
5750779 |
tttggaaattaggatgaaggagaggggaaaaggaaaattgggaagggtggtgcgcgtgaaacagaaatggtggaatttgtcacgcgcttaacgcgtgatt |
5750680 |
T |
 |
| Q |
201 |
gcacgtgctgtaaaaggccggttcggcccaaagtagtattgaactttgtttgtttctggtgttttaataccgacggtagtt-------tctactttctaa |
293 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||| |||||||||||| |
|
|
| T |
5750679 |
gcacgtgctgtaaaaggccggttcggcccaaagtagtattgaactttgtttgtttctggtgttttaatactgacggtagtttctagtttctactttctaa |
5750580 |
T |
 |
| Q |
294 |
caaacnnnnnnncattaattttcacttattcatatctatgatgtgtgattcttctcattaggctttttgaagg |
366 |
Q |
| |
|
||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
5750579 |
caaacaaaaaaacattaattttcacttattcatatctatgatgtgtgattcttctcattaggctttttgaagg |
5750507 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 1 - 29
Target Start/End: Complemental strand, 5750908 - 5750880
Alignment:
| Q |
1 |
cggagtttgttacgattggtttggttcag |
29 |
Q |
| |
|
||||||||||||||||||||||||||||| |
|
|
| T |
5750908 |
cggagtttgttacgattggtttggttcag |
5750880 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University