View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3651_low_19 (Length: 301)
Name: NF3651_low_19
Description: NF3651
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3651_low_19 |
 | |
|
| [»] chr5 (1 HSPs) |
| |
|
Alignment Details
Target: chr5 (Bit Score: 209; Significance: 1e-114; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 209; E-Value: 1e-114
Query Start/End: Original strand, 61 - 301
Target Start/End: Original strand, 27473829 - 27474069
Alignment:
| Q |
61 |
gcaacatatttaaaatcaaggttcaaacactaaccattttaatgaaatattttaaatacaatctctcccaaaatctcaatccaaaataactaatttcttt |
160 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||| |||||||||||||||||||||||||||||||||||||| |
|
|
| T |
27473829 |
gcaacatatttaaaatcaaggttcaaacactaaccattttaatgaaatatttcaaatacaacctctcccaaaatctcaatccaaaataactaatttcttt |
27473928 |
T |
|
| Q |
161 |
aacaaagattcactcaaaacaaaaaggttcatatgaaatagagagaaaaacaaaatggaacgattcatcaaattcttgatacttctatcaaaaatttttg |
260 |
Q |
| |
|
|||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||| |||||| |
|
|
| T |
27473929 |
aacaaagattcattcaaaacaaaaaggttcatatgaaatagagagaaaaacaaaatggaacgattcatcaaattcttgatccttctatcaaatttttttg |
27474028 |
T |
|
| Q |
261 |
acgtgctattactatctttgagatgaagaagaaccagaatc |
301 |
Q |
| |
|
|||| ||||||||||||||||||||||||||||||| |||| |
|
|
| T |
27474029 |
acgtactattactatctttgagatgaagaagaaccaaaatc |
27474069 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University