View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3651_low_27 (Length: 250)
Name: NF3651_low_27
Description: NF3651
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3651_low_27 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 179; Significance: 1e-96; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 179; E-Value: 1e-96
Query Start/End: Original strand, 1 - 243
Target Start/End: Complemental strand, 48518335 - 48518100
Alignment:
| Q |
1 |
aacaaaacctgcaacttgattgcagtgacaaacatgaacaagaatataatggcaattatataaagaattgagagaacttagagagagtaaattgtagaat |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
48518335 |
aacaaaacctgcaacttgattgcagtgacaaacatgaacaagaatatagtggcaattatataaagaattgagagactttagagagagtaaattgtagaat |
48518236 |
T |
 |
| Q |
101 |
ggattatctttattatttccttgatgaacaattacaatccttatgcaggcctaacaattataactaattagtaacgtactaactaacttggttacattct |
200 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||| ||||| |||||||||||||||||||||||||||||||| |
|
|
| T |
48518235 |
ggattatctttattatttccttgatgaacaattacaatccttatgtaggcctaacaattatcactaactagtaacgtactaactaacttggttacattct |
48518136 |
T |
 |
| Q |
201 |
gtattaattaagcaactaattacataatgtctcccctttgcta |
243 |
Q |
| |
|
| ||| |||||||||| ||||||||||||||||| |||| |
|
|
| T |
48518135 |
g--tta--taagcaacta---acataatgtctccccttggcta |
48518100 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University