View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3651_low_32 (Length: 245)
Name: NF3651_low_32
Description: NF3651
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3651_low_32 |
 |  |
|
| [»] chr3 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 217; Significance: 1e-119; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 217; E-Value: 1e-119
Query Start/End: Original strand, 1 - 245
Target Start/End: Complemental strand, 41036772 - 41036528
Alignment:
| Q |
1 |
tgttgtctcaccggcggacacgtgacaagtttttaatttgaagttacttttttcagttaacatatagttagttacacattggtcaaacaaattaacatgc |
100 |
Q |
| |
|
|||||||||| |||||||||| |||||||||||| |||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41036772 |
tgttgtctcagtggcggacacgagacaagtttttagtttgaaattacttttttcagttaacatatagttagttacacattggtcaaacaaattaacatgc |
41036673 |
T |
 |
| Q |
101 |
agctatgatcaatgtgctattgagttatgctatgtgtcattgcattgcagaggttggaagcaatacatgaatcgaatcccttaaccaattcaaatttagt |
200 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||| |
|
|
| T |
41036672 |
agctatgatcaatgtgctattgagttatgctatgtgtcattgcattgcagaggttggaagcaatacatgaatcaaatcccttaaccaattcaaatttagt |
41036573 |
T |
 |
| Q |
201 |
tgagatattcaagtcagaaactagcaaaggaaatgcaaagaagag |
245 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| ||||||||| |
|
|
| T |
41036572 |
tgagatattcaagtcagaaactagcaaaggaaatggaaagaagag |
41036528 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University