View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3651_low_40 (Length: 206)
Name: NF3651_low_40
Description: NF3651
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3651_low_40 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 155; Significance: 2e-82; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 155; E-Value: 2e-82
Query Start/End: Original strand, 35 - 189
Target Start/End: Complemental strand, 36899440 - 36899286
Alignment:
| Q |
35 |
atgtaagtaaagtttgacaaataattattatagatttatggtcacgattgtattagagtaaaatttaataattctctagtgattggaagatacataccaa |
134 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36899440 |
atgtaagtaaagtttgacaaataattattatagatttatggtcacgattgtattagagtaaaatttaataattctctagtgattggaagatacataccaa |
36899341 |
T |
 |
| Q |
135 |
gtgtgtcaccagccctaaatcgttttcctcgagaccacccaaccgtgttaaaggt |
189 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36899340 |
gtgtgtcaccagccctaaatcgttttcctcgagaccacccaaccgtgttaaaggt |
36899286 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 32; E-Value: 0.000000004
Query Start/End: Original strand, 122 - 189
Target Start/End: Original strand, 37008905 - 37008972
Alignment:
| Q |
122 |
agatacataccaagtgtgtcaccagccctaaatcgttttcctcgagaccacccaaccgtgttaaaggt |
189 |
Q |
| |
|
|||||||||||||| || |||||||||||||| |||||||| || ||| ||||| ||||||||||| |
|
|
| T |
37008905 |
agatacataccaagggtatcaccagccctaaagcgttttccattaggccatccaacagtgttaaaggt |
37008972 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University