View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF3652_high_3 (Length: 262)

Name: NF3652_high_3
Description: NF3652
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF3652_high_3
NF3652_high_3
[»] chr2 (1 HSPs)
chr2 (1-254)||(36698818-36699071)
[»] scaffold0009 (2 HSPs)
scaffold0009 (69-239)||(143777-143948)
scaffold0009 (1-72)||(143999-144070)


Alignment Details
Target: chr2 (Bit Score: 230; Significance: 1e-127; HSPs: 1)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 230; E-Value: 1e-127
Query Start/End: Original strand, 1 - 254
Target Start/End: Complemental strand, 36699071 - 36698818
Alignment:
1 gttggcattggcgggccgaattgaatagtaactgattttctttgcagggataccagaaacatggaaaccttgtgcaaacagaaacactcatctcttcttt 100  Q
    |||||||||||||||||||| |||||||||||| ||||||||| |||||||| |||||||||||||||||||||||||||||||||||||||||||||||    
36699071 gttggcattggcgggccgaactgaatagtaactaattttctttacagggatatcagaaacatggaaaccttgtgcaaacagaaacactcatctcttcttt 36698972  T
101 gatgatcacccgtctcaaattgccaacaaaatatatgcaacacgttgctttattgagaagacaatatgcaagccatctggcttcaagatgctctaattaa 200  Q
    ||||||||| ||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
36698971 gatgatcacgcgtctcaaattgccaacaaaatatatgcaacacattgctttattgagaagacaatatgcaagccatctggcttcaagatgctctaattaa 36698872  T
201 taatcagttgtattatttgaacaacaaaattcaaatatacgccctaagtataat 254  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||    
36698871 taatcagttgtattatttgaacaacaaaattcaaatatacgccctaagtataat 36698818  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0009 (Bit Score: 140; Significance: 2e-73; HSPs: 2)
Name: scaffold0009
Description:

Target: scaffold0009; HSP #1
Raw Score: 140; E-Value: 2e-73
Query Start/End: Original strand, 69 - 239
Target Start/End: Complemental strand, 143948 - 143777
Alignment:
69 cttgtgcaaacagaaacactcatctcttctttgatgatcacccgtctcaaattgccaacaaaatatatgcaacacgttgctttattgagaagacaatatg 168  Q
    ||||| ||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||| |||||||||||||||||    
143948 cttgttcaaacagaaacactcatctcttctttgatgatcacccctctcaaattgccaacaaaatatatgcaacacgttgcttcattgagaagacaatatg 143849  T
169 caagccatctggcttcaagatgctctaattaat-aatcagttgtattatttgaacaacaaaattcaaatata 239  Q
    |||||||||| ||||||| |||||||||||||| ||||||||||||||||||||||||||||| ||||||||    
143848 caagccatctagcttcaaaatgctctaattaataaatcagttgtattatttgaacaacaaaatacaaatata 143777  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0009; HSP #2
Raw Score: 52; E-Value: 7e-21
Query Start/End: Original strand, 1 - 72
Target Start/End: Complemental strand, 144070 - 143999
Alignment:
1 gttggcattggcgggccgaattgaatagtaactgattttctttgcagggataccagaaacatggaaaccttg 72  Q
    ||||||||||| || ||||||||||||||||||||||||||||| |||||||  ||||||||||||||||||    
144070 gttggcattggtggaccgaattgaatagtaactgattttctttgtagggatattagaaacatggaaaccttg 143999  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University