View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3652_high_3 (Length: 262)
Name: NF3652_high_3
Description: NF3652
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3652_high_3 |
 |  |
|
| [»] scaffold0009 (2 HSPs) |
 |  |  |
|
Alignment Details
Target: chr2 (Bit Score: 230; Significance: 1e-127; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 230; E-Value: 1e-127
Query Start/End: Original strand, 1 - 254
Target Start/End: Complemental strand, 36699071 - 36698818
Alignment:
| Q |
1 |
gttggcattggcgggccgaattgaatagtaactgattttctttgcagggataccagaaacatggaaaccttgtgcaaacagaaacactcatctcttcttt |
100 |
Q |
| |
|
|||||||||||||||||||| |||||||||||| ||||||||| |||||||| ||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36699071 |
gttggcattggcgggccgaactgaatagtaactaattttctttacagggatatcagaaacatggaaaccttgtgcaaacagaaacactcatctcttcttt |
36698972 |
T |
 |
| Q |
101 |
gatgatcacccgtctcaaattgccaacaaaatatatgcaacacgttgctttattgagaagacaatatgcaagccatctggcttcaagatgctctaattaa |
200 |
Q |
| |
|
||||||||| ||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36698971 |
gatgatcacgcgtctcaaattgccaacaaaatatatgcaacacattgctttattgagaagacaatatgcaagccatctggcttcaagatgctctaattaa |
36698872 |
T |
 |
| Q |
201 |
taatcagttgtattatttgaacaacaaaattcaaatatacgccctaagtataat |
254 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36698871 |
taatcagttgtattatttgaacaacaaaattcaaatatacgccctaagtataat |
36698818 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0009 (Bit Score: 140; Significance: 2e-73; HSPs: 2)
Name: scaffold0009
Description:
Target: scaffold0009; HSP #1
Raw Score: 140; E-Value: 2e-73
Query Start/End: Original strand, 69 - 239
Target Start/End: Complemental strand, 143948 - 143777
Alignment:
| Q |
69 |
cttgtgcaaacagaaacactcatctcttctttgatgatcacccgtctcaaattgccaacaaaatatatgcaacacgttgctttattgagaagacaatatg |
168 |
Q |
| |
|
||||| ||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||| ||||||||||||||||| |
|
|
| T |
143948 |
cttgttcaaacagaaacactcatctcttctttgatgatcacccctctcaaattgccaacaaaatatatgcaacacgttgcttcattgagaagacaatatg |
143849 |
T |
 |
| Q |
169 |
caagccatctggcttcaagatgctctaattaat-aatcagttgtattatttgaacaacaaaattcaaatata |
239 |
Q |
| |
|
|||||||||| ||||||| |||||||||||||| ||||||||||||||||||||||||||||| |||||||| |
|
|
| T |
143848 |
caagccatctagcttcaaaatgctctaattaataaatcagttgtattatttgaacaacaaaatacaaatata |
143777 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0009; HSP #2
Raw Score: 52; E-Value: 7e-21
Query Start/End: Original strand, 1 - 72
Target Start/End: Complemental strand, 144070 - 143999
Alignment:
| Q |
1 |
gttggcattggcgggccgaattgaatagtaactgattttctttgcagggataccagaaacatggaaaccttg |
72 |
Q |
| |
|
||||||||||| || ||||||||||||||||||||||||||||| ||||||| |||||||||||||||||| |
|
|
| T |
144070 |
gttggcattggtggaccgaattgaatagtaactgattttctttgtagggatattagaaacatggaaaccttg |
143999 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University