View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3652_low_7 (Length: 242)
Name: NF3652_low_7
Description: NF3652
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3652_low_7 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 165; Significance: 2e-88; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 165; E-Value: 2e-88
Query Start/End: Original strand, 15 - 224
Target Start/End: Complemental strand, 2615905 - 2615701
Alignment:
| Q |
15 |
tattgcaagttttgttttatgagcaaactctataattcgtgtaccccttcaaatattatagtatattactacaattaatttgggtttaccaacatgtagg |
114 |
Q |
| |
|
|||||||||||||||| ||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2615905 |
tattgcaagttttgtt-----agcaaactctataattcgtgtcccccttcaaatattatagtatattactacaattaatttgggtttaccaacatgtagg |
2615811 |
T |
 |
| Q |
115 |
ttggggctaaggtgtannnnnnncccttaaccctggtgttcctttgatttcttttttaaggaaggtgtacctttgaaaatgaacatcaataatctaaaat |
214 |
Q |
| |
|
|||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2615810 |
ttggggctaaggtgtattttttccccttaaccctggtgttcctttgatttcttttttaaggaaggtgtacctttgaaaatgaacatcaataatctaaaat |
2615711 |
T |
 |
| Q |
215 |
ttgactcata |
224 |
Q |
| |
|
|||||||||| |
|
|
| T |
2615710 |
ttgactcata |
2615701 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University