View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3653_low_7 (Length: 347)
Name: NF3653_low_7
Description: NF3653
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3653_low_7 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 279; Significance: 1e-156; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 279; E-Value: 1e-156
Query Start/End: Original strand, 45 - 335
Target Start/End: Complemental strand, 25746925 - 25746635
Alignment:
| Q |
45 |
tgatattgcagaaattaatatggtctattgtttgaatattttcttatttcatgaagctttatctttttaatgtaacatcttatacatttttacaatgaca |
144 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||| |
|
|
| T |
25746925 |
tgatattgcagaaattaatatggtctattgtttgaatattttcttatttcatgaagctttatctttttaatgttacatcttatacatttttacaatgaca |
25746826 |
T |
 |
| Q |
145 |
ggaagcatatagacagaaactggatgacaaattgaatttggattcagaagggagaccgtttcggatgttggtatttaggggaagtccaaaatcaagtaaa |
244 |
Q |
| |
|
||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
25746825 |
ggaagcatatagacagaaactggatgacaaactgaatttggattcagaagggagaccgtttcggatgttggtatttaggggaagtccaaaatcaagtaaa |
25746726 |
T |
 |
| Q |
245 |
aaatctattcgttatattgatcagctgcgagaagaagatgctgcagcacttcaaaacagttccaatcaacgtatccatcgaaggctgccta |
335 |
Q |
| |
|
|| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
25746725 |
aagtctattcgttatattgatcagctgcgagaagaagatgctgcagcacttcaaaacagttccaatcaacgtatccatcgaaggctgccta |
25746635 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University