View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3654_high_16 (Length: 238)
Name: NF3654_high_16
Description: NF3654
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3654_high_16 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 220; Significance: 1e-121; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 220; E-Value: 1e-121
Query Start/End: Original strand, 1 - 224
Target Start/End: Complemental strand, 2287283 - 2287060
Alignment:
| Q |
1 |
tttgcctggaattgttctagcaacttgtgctattgctctttcttttcctgccactagttcaactgctcttgtgccttgtggaactgagaaatgagctgag |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2287283 |
tttgcctggaattgttctagcaacttgtgctattgcactttcttttcctgccactagttcaactgctcttgtgccttgtggaactgagaaatgagctgag |
2287184 |
T |
 |
| Q |
101 |
tctaggtattttactgcttttaaggattctaccatccatcctgggagaggtgaatggtcatcttcaatattgggtgggatgatcactccatatgatgtgt |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2287183 |
tctaggtattttactgcttttaaggattctaccatccatcctgggagaggtgaatggtcatcttcaatattgggtgggatgatcactccatatgatgtgt |
2287084 |
T |
 |
| Q |
201 |
tgggaaaaatataaggtccttctt |
224 |
Q |
| |
|
|||||||||||||||||||||||| |
|
|
| T |
2287083 |
tgggaaaaatataaggtccttctt |
2287060 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 29; Significance: 0.0000003; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 24 - 144
Target Start/End: Complemental strand, 44409578 - 44409458
Alignment:
| Q |
24 |
cttgtgctattgctctttcttttcctgccactagttcaactgctcttgtgccttgtggaactgagaaatgagctgagtctaggtattttactgcttttaa |
123 |
Q |
| |
|
||||||| | ||| |||||||||||||| || ||||||| ||||||| | |||| ||| |||| ||| || | || || | ||||||||||||||| | |
|
|
| T |
44409578 |
cttgtgcaagtgcactttcttttcctgctacaagttcaattgctctttttccttctggtactgtgaagtgttcagaatcaatgtattttactgctttcag |
44409479 |
T |
 |
| Q |
124 |
ggattctaccatccatcctgg |
144 |
Q |
| |
|
||||| || ||||||||||| |
|
|
| T |
44409478 |
agattcaactatccatcctgg |
44409458 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University