View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3654_low_7 (Length: 323)
Name: NF3654_low_7
Description: NF3654
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3654_low_7 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 263; Significance: 1e-146; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 263; E-Value: 1e-146
Query Start/End: Original strand, 6 - 307
Target Start/End: Original strand, 55575098 - 55575402
Alignment:
| Q |
6 |
aacacatctggttaaattcaactacttctattttctcaaattaccagtgtcggtgtgtcagtgtttcataaaaatgaggcatcaaaacatcttgtaatct |
105 |
Q |
| |
|
|||||||||||||| |||||| |||||||||||||||||||||| |||||||||||||| |||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
55575098 |
aacacatctggttacattcaattacttctattttctcaaattactagtgtcggtgtgtcggtgtttcataaaaatgaggcatcaaaacatcttgtaatct |
55575197 |
T |
|
| Q |
106 |
acatataacttg---taatctacatgaaatttgaatctcccaaacttacaaaccttgatgtcactgattgaacagaatgaaagacctccactgcctgcaa |
202 |
Q |
| |
|
|||||||||||| |||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||| |
|
|
| T |
55575198 |
acatataacttggaataattgacatgaaatttgaatctcccaaacttacaaaccttgatgtcactgattgaacagaatgaaaggcctccactgcctgcaa |
55575297 |
T |
|
| Q |
203 |
gttgtcagccagcacttgcacacctaataaagcgttgttggtcagcaaatccttcaaagaggccagatttcagttatattgtgtctactcttgagaggta |
302 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
55575298 |
gttgtcagccagcacttgcacacctaataaagcgttgttggtcagcaaatccttcaaagaggccagatttcagttatattgtgtctactcttgagaggta |
55575397 |
T |
|
| Q |
303 |
tgatg |
307 |
Q |
| |
|
||||| |
|
|
| T |
55575398 |
tgatg |
55575402 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University