View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3655_high_6 (Length: 231)
Name: NF3655_high_6
Description: NF3655
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3655_high_6 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 149; Significance: 8e-79; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 149; E-Value: 8e-79
Query Start/End: Original strand, 37 - 213
Target Start/End: Complemental strand, 23876135 - 23875959
Alignment:
| Q |
37 |
cggttaatatgtatgaaaatgttttaccaacaagtggctaaattgaataataatatcaacacttgccaagtagttcgctttcacaatttccactactgca |
136 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||| || ||||||||||||||||||||||| |
|
|
| T |
23876135 |
cggttaatatgtatgaaaatgttttaccaacaggtggctaaattgaataataatatcaacacttgccaagtagctctctttcacaatttccactactgca |
23876036 |
T |
|
| Q |
137 |
gtcactgtctgatgcaacaccaagtccctcaaagcctccctttgacgtttctgaaactaagatatgatattgatttg |
213 |
Q |
| |
|
|||||||||||| |||||||||||||| ||||||||||||||||||||||||| ||| ||||||||||||||||||| |
|
|
| T |
23876035 |
gtcactgtctgacgcaacaccaagtccttcaaagcctccctttgacgtttctggaaccaagatatgatattgatttg |
23875959 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University