View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3656_high_16 (Length: 255)
Name: NF3656_high_16
Description: NF3656
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3656_high_16 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 182; Significance: 2e-98; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 182; E-Value: 2e-98
Query Start/End: Original strand, 16 - 242
Target Start/End: Original strand, 7171059 - 7171285
Alignment:
| Q |
16 |
atctttttctccaattgggtatacacaaaatagttttgtattagatttcgctatcgaagtctccaaatcgcaagcaaatcttcgttcnnnnnnngtcatt |
115 |
Q |
| |
|
|||||||||||||||||||| |||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||| |||||| |
|
|
| T |
7171059 |
atctttttctccaattgggtgtacacaaaatagttttctattagatttcgctatcgaagtctccaaatcgcaagcaaatcttcgttctttttttgtcatt |
7171158 |
T |
 |
| Q |
116 |
ggttgatatcgaatcattattatatcctctatgatcgagacaaataatatgttgcagaagatgaataggctaaagatgaattcaattattaccagcttca |
215 |
Q |
| |
|
|||| ||||||||||||| |||||||| |||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||| |
|
|
| T |
7171159 |
ggtttatatcgaatcattgttatatccactatgatcgagacaaataatatgttgcagaagatgaataggctaaaaatgaattcaattattaccagcttca |
7171258 |
T |
 |
| Q |
216 |
agattgttctcgtttccctcagttttc |
242 |
Q |
| |
|
||||||||||||||||||||||||||| |
|
|
| T |
7171259 |
agattgttctcgtttccctcagttttc |
7171285 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University