View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3656_high_26 (Length: 226)
Name: NF3656_high_26
Description: NF3656
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3656_high_26 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 163; Significance: 3e-87; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 163; E-Value: 3e-87
Query Start/End: Original strand, 1 - 219
Target Start/End: Complemental strand, 39146460 - 39146242
Alignment:
| Q |
1 |
caagtaatcattcactacttgtggatggtgagcacacgtaaaaggtagagggaaactagaatcaacttttctcacagcaagcaatgtcctgatttggtta |
100 |
Q |
| |
|
||||||||||| ||||||||||||||||||||||||||||||||||| | |||||||| ||||||||||||||| ||||||||| ||||||||||||||| |
|
|
| T |
39146460 |
caagtaatcatacactacttgtggatggtgagcacacgtaaaaggtaaatggaaactaaaatcaacttttctcaaagcaagcaaagtcctgatttggtta |
39146361 |
T |
 |
| Q |
101 |
atatgttgaacaaggttcattctaattttggttcgatgttaatgtggttggactttgtcgtgcaattttatttctgtttttgtagcaattgtgttcaaca |
200 |
Q |
| |
|
|||||||||||||||||||||| |||||||||||||||||||||||||||||||||||| |||||||||||||||||||||| ||||| || ||||||| |
|
|
| T |
39146360 |
atatgttgaacaaggttcattccaattttggttcgatgttaatgtggttggactttgtcttgcaattttatttctgtttttggagcaagtgacttcaaca |
39146261 |
T |
 |
| Q |
201 |
catactcttctgtcttaaa |
219 |
Q |
| |
|
|| ||||||| |||||||| |
|
|
| T |
39146260 |
caaactcttcagtcttaaa |
39146242 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University