View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3656_low_13 (Length: 377)
Name: NF3656_low_13
Description: NF3656
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3656_low_13 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 283; Significance: 1e-158; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 283; E-Value: 1e-158
Query Start/End: Original strand, 34 - 337
Target Start/End: Original strand, 37984564 - 37984871
Alignment:
| Q |
34 |
tgtgaataatgcattgaattgtttagc----tagcttaccattttggagagagtttgaaaagtttcaatttctcaaacaagaatgatgagttgagattga |
129 |
Q |
| |
|
||||||||||||||||||||||||||| ||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37984564 |
tgtgaataatgcattgaattgtttagctagctagcttaccattttggagagagtatgaaaagtttcaatttctcaaacaagaatgatgagttgagattga |
37984663 |
T |
|
| Q |
130 |
aatgagaagaaggtgaacatataaacccaaaatagaaacttttgaaagaagctttcacttgagagcaaaatgacttagaattttaatcataaaaatccac |
229 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||| |
|
|
| T |
37984664 |
aatgagaagaaggtgaacatataaacccaaaatagaaacttttgaaagaagctttcacttgagagcaaaatgacttagaattttgatcataaaaatccac |
37984763 |
T |
|
| Q |
230 |
aagaggttcttatttttaatgtcttacactgttggttctgttctttggtatttgtcttccattctagtattctagtatttatgatgtttttttctcactc |
329 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37984764 |
aagaggttcttatttttaatgtcttacactgttggttctgttctttggtatttgtcttccattctagtattctagtatttatgatgtttttttctcactc |
37984863 |
T |
|
| Q |
330 |
tttctacc |
337 |
Q |
| |
|
|||||||| |
|
|
| T |
37984864 |
tttctacc |
37984871 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 35; Significance: 0.0000000001; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 248 - 299
Target Start/End: Original strand, 28007085 - 28007140
Alignment:
| Q |
248 |
atgtcttacactgttggttctgttctttggtatt----tgtcttccattctagtat |
299 |
Q |
| |
|
|||||||||||||||||||||||||||||| ||| |||||||||||||||||| |
|
|
| T |
28007085 |
atgtcttacactgttggttctgttctttggcatttgaatgtcttccattctagtat |
28007140 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University